a natural language system for spoken language applications

... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... this paper describes the lexicon, grammar, and semantics of English, Gemini has also been used in a Japanese spo- ken language understanding system (Kameyama, 1992). 2.1. Grammar Formalism ... syntac- tic, semantic, and lexical rules are applied by a bottom-up all-paths constituent parser to populate a chart with edges containing syntactic, seman- tic, and logical form information....

Ngày tải lên: 20/02/2014, 21:20

... Recognition Evaluation (LRE) data. The database was intended to establish a baseline of performance capability for language recognition of conversational tele- phone speech. The database contains recorded ... 515–522, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Phonotactic Language Model for Spoken Language Identification Haizhou Li and Bin Ma Institute for Infocomm Research ... identification us- ing Gaussian Mixture model tokenization , in Proc. of ICASSP. Yonghong Yan, and Etienne Barnard. 1995. An ap- proach to automatic language identification based on language dependent...

Ngày tải lên: 20/02/2014, 15:20

Ngày tải lên: 31/03/2014, 04:20

... Lee, L. S. et al. (1990). A Mandarin Dictation Machine Based Upon A Hierarchical Recognition Approach and Chinese Natural Language Analysis, IEEE Trans. on Pattern Analysis and Machine Intelligence, ... grammars, compared with other grarnmal~cal approaches, are more declarative and can better integrate syntactic and semantic information to eliminate illegal combinations; while Markov language ... unification granunar and Markov language model are integrated in a word lattice parsing algorithm based on an augmented chart, and the island-driven parsing concept is combined with various...

Ngày tải lên: 08/03/2014, 07:20

Ngày tải lên: 20/06/2014, 22:20

... điệuc a âm thanhnhiềungữ điệuc a âm thanhnhiều ngữ điệu c a âm thanhnhiều ngữ điệu c a âm thanh  Thành phần quản lý hội thoại có chức năng Thành phần quản lý hội thoại có chức năng giao tiếp ... chuyển đổi kết quả nhận dạng tiếng nói sang dạng ngữ ngh a đượcquyướcnói sang dạng ngữ ngh a đượcquyướcnói sang dạng ngữ ngh a được quy ướcnói sang dạng ngữ ngh a được quy ước Bài 3:Bài 3: Kiến trúc ... vị tác động c a nhiễucáchphátâmâm, âm vị, tác động c a nhiễu, cách phát âm âm, âm vị, tác động c a nhiễu, cách phát âm c a nhiều người nói khác nhauc a nhiều người nói khác nhau –– Các mô hình...

Ngày tải lên: 14/12/2013, 10:15

... and a data- driven approach. Traditionally, information ex- traction and language understanding fields have usually used a syntactic parser to encode global information (e.g. parse tree path, ... Incorporating Non-local Information 3.1 Using Trigger Features To exploit non-local information to sequential la- beling for a statistical SLU, we can use two ap- proaches; a syntactic parser-based and ... long-distance de- pendencies to improve performance on the statistical spoken language understanding (SLU) problem. The statistical natural language parsers trained on text perform unreliably to...

Ngày tải lên: 20/02/2014, 12:20

... Understanding aims at mapping a natural language spoken sen- tence into a semantic representation. In the last decade two main approaches have been pursued: generative and discrimi- native models. ... European Chapter of the ACL, pages 202–210, Athens, Greece, 30 March – 3 April 2009. c 2009 Association for Computational Linguistics Re-Ranking Models For Spoken Language Understanding Marco Dinarelli University ... and 180 Human-Human (HH) dialogs are available. Statistics on LUNA corpus are reported in Table 1. The corpus MEDIA was collected within the French project MEDIA-EVALDA (Bonneau- Maynard et al.,...

Ngày tải lên: 08/03/2014, 21:20

... adaptation across languages, enabling the adaptation of a LM from one language based on the adaptation text of another language. In statistical machine translation (SMT), one approach is to ap- ply ... 2007. c 2007 Association for Computational Linguistics Bilingual-LSA Based LM Adaptation for Spoken Language Translation Yik-Cheung Tam and Ian Lane and Tanja Schultz InterACT, Language Technologies ... tar- get language N-gram LM via marginal adap- tation. The proposed framework also en- ables rapid bootstrapping of LSA models for new languages based on a source LSA model from another language. ...

Ngày tải lên: 17/03/2014, 04:20

... understanding systems typically pass the transcript produced by a speech rec- ognizer into a natural language parser with no integration of acoustic and grammatical con- straints. One reason for ... Finite-State Parsing for Spoken Language Understanding Edward C. Kaiser Center for Spoken Language Understanding Oregon Graduate Institute PO Box 91000 Portland OR 97291 kaiserâcse, ogi. edu Abstract ... Power of Regular Grammars Tomita (1986) has argued that context-free grammars (CFGs) are over-powered for natu- ral language. Chart parsers are designed to deal with the worst case of very-deep...

Ngày tải lên: 17/03/2014, 07:20

Ngày tải lên: 24/03/2014, 03:20

Ngày tải lên: 01/04/2014, 00:20

... data, and possibly a single fragmented block. If a file system block must be fragmented to obtain space for a small amount of data, the remaining fragments of the block are made available for allocation ... the data throughput rates that many applications require. For example, applications such as VLSI design and image processing do a small amount of processing on a large quanti- ties of data and ... blocks that a user may allocate. A separate quota can be set for each user on each file system. Resources are given both a hard and a soft limit. When a program exceeds a soft limit, a warn- ing...

Ngày tải lên: 12/09/2012, 14:16

... that contains all logic data of application. Separating logic data from application into it will make program scalable and higher performance. Most of web applications today use Relational Database ... operating system. - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily. - Quick delivery: web-based model make it portable to ... load data from the system because only a part of web page is updated. It does not need to load entire web page. - Access management: each user can access content and use many features that are...

Ngày tải lên: 27/10/2012, 16:40

Ngày tải lên: 05/09/2013, 09:08

... proposed that consists of cooperative working platform, consulting platform, individual KM platform , organizational KM platform, and knowledge transfer platform. This system can effectively manage ... addition, the same question can be asked again and again and the quality of the answers can not be guaranteed. Therefore, the organiza- tion can have personnel in charge of monitoring and tracking questions ... Venkataramanan M. 2003. Enter- prise resource planning: managing the implementa- tion process. European Journal of Operational Research 146: 302–314. Motwni J, Mirchandani D, Madan M, Gunasekaran...

Ngày tải lên: 16/01/2014, 16:33

... TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 8 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 9 ... GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA 20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT 21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23...

Ngày tải lên: 16/03/2014, 01:20

... Pharmaceutical University, 5 Nakauchi-cho, Misasagi, Yamashina-ku, Kyoto 607-8414, Japan. Fax: + 81 75 595 4758, Tel.: + 81 75 595 4653, E-mail: hatayama@mb.kyoto-phu.ac.jp Abbreviations: SA, ... cyclooxygenase and nuclear factor-kappa B activation [9,10]. In addition to the anti-inflammatory effects, it is noteworthy that SA which can activate HSF Fig. 4. Effect of SA on accumulation of Hsp105 and ... simple screening system for stress response modulators in mammalian cells Keiichi Ishihara, Kenji Horiguchi, Nobuyuki Yamagishi and Takumi Hatayama Department of Biochemistry, Kyoto Pharmaceutical University,...

Ngày tải lên: 17/03/2014, 10:20

... OA7) Scan (OA1,"Publications", OA6) CreateSet (OA4, OA5) Scan (OA1,"Name",OA4) SetOp (Union,OA5, OA6, OA7) Select (OA3 = TRUE) Aggr (Exists, OA2, OA3) Select (OA2 = "CS") Scan (OA1,"Dept",OA2) ... Data Manager Query Optimizer Query Plan Generator Preprocessing (Lorel to OQL) Parsing HTML GUI Textual Interface API Applications Lore System Queries Select (OA3 = TRUE) Aggr (Exists, OA2, OA3) Select (OA2 ... ) Scan (OA1,"Dept",OA2) Join Scan (OA0,"Member",OA1) Scan (Root,"DBGroup",OA0) Join Join Scan (OA0,"Member",OA1) Scan (Root,"DBGroup",OA0) Join From clause From and Where clauses Final Query Plan Scan (OA0,"Member",OA1) Scan (Root,"DBGroup",OA0) Join Join Project (OA7) Aggr (Count, OA6, OA7) Scan (OA1,"Publications", OA6) CreateSet (OA4,...

Ngày tải lên: 23/03/2014, 12:20

... not readily available (Zhao et al., 2010). In contrast, bilingual parallel data is in abundance and has been used in extracting paraphrase (Ban- nard and Callison-Burch, 2005; Zhao et al., 2008b; Callison-Burch, ... issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase changes less gets larger BLEU score and the evaluations of paraphrase quality and rate tend to be incompatible. To ... and William B. Dolan. 2011. Collecting highly parallel data for paraphrase evaluation. In ACL, pages 190–200. David Chiang. 2007. Hierarchical phrase-based transla- tion. Computational Linguistics,...

Ngày tải lên: 23/03/2014, 14:20