The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

The small GTPASE   ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

... ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 human Arl8 human Arl8 human Arl4 human Arl4...
Ngày tải lên : 17/09/2015, 17:20
  • 184
  • 301
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 700
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Ngày tải lên : 14/03/2014, 23:20
  • 11
  • 396
  • 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

... GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, ... HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C NCOA3-D NR...
Ngày tải lên : 14/08/2014, 20:22
  • 14
  • 331
  • 0
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC ......
C  elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC ......
Ngày tải lên : 02/10/2015, 12:56
  • 85
  • 157
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

... therefore used this assay to analyze the interaction of Rabaptin-5d with Rab4 and Rab5 Similarly to Rabaptin-5, Rabaptin-5d was not able to bind Rab4 or Rab5 in the inactive, GDP-bound form as ... Rab4 binding domain, and the region deleted in Rabaptin-5d are numbered according to the amino acid sequence of mouse Rabaptin-5 (GeneBank Accession No D...
Ngày tải lên : 16/03/2014, 18:20
  • 10
  • 411
  • 0
Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc

Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc

... evaluated the capability of the ASC isoforms to interact with caspase Because activation of caspase would result in proteolytic cleavage of the CARD of pro -caspase 1, we expressed the C28 5A catalytically ... article as: Bryan et al., Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain...
Ngày tải lên : 11/08/2014, 03:20
  • 13
  • 231
  • 0
The role of the small GTPase rab31 in cancer

The role of the small GTPase rab31 in cancer

... overexpression of Rab31 in breast cancer cell lines actually enhanced proliferation [112], Rab31, when elevated in the presence of MUC1-C may enhance instead of retard EGFR signalling in these cells Another ... as the lysosome inhibitor chloroquine increased MUC1-C levels in Rab31 silenced cells How then does Rab31 diminish late endososome-lysosome targeting of MU...
Ngày tải lên : 22/09/2015, 15:17
  • 10
  • 352
  • 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 658
  • 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... (2 010 ) 2 611 –2627 ª 2 010 The Authors Journal compilation ª 2 010 FEBS A B Mantsyzov et al 10 11 12 13 14 15 16 17 domain of release factor eRF1 functions in stop codon recognition RNA 6, 12 36 12 47 ... = 10 8 (s )1) Dyy = 10 8 (s )1) Dzz = 10 8 (s )1) s1 = (4Dxx + Dyy + Dzz) )1 (ns) s2 = (Dxx + 4Dyy + Dzz) )1 (ns) s3 = (Dxx + Dyy + 4Dzz) )1 (ns) 0 .10 2 0 .12 5 0...
Ngày tải lên : 06/03/2014, 11:20
  • 17
  • 490
  • 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria...
Ngày tải lên : 07/03/2014, 00:20
  • 13
  • 390
  • 0
Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx

Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx

... ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae ... Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Fig Alignment of PP2A from S...
Ngày tải lên : 08/03/2014, 22:20
  • 11
  • 447
  • 0

Xem thêm