Surface and molecular modification of polyimides via graft copolymerization and functionalization

... SURFACE AND MOLECULAR MODIFICATION OF POLYIMIDES VIA GRAFT COPOLYMERIZATION AND FUNCTIONALIZATION WANG WENCAI (M.Eng., BUCT) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... surface properties of polyimide (PI) and fluorinated polyimide (FPI), molecular redesign and functionalization via graft polymerization have been carried out Surface...

Ngày tải lên: 17/09/2015, 17:20

... 45 Chapter Fabrication of Micro/nano Polymeric Patterns Through Reactive Reversal Nanoimprint Lithography and Surface- Initiated Polymerization 50 3.1 Introduction to Surface- initiated ... nano-architectures via a combination of reactive reversal nanoimprint lithography (NIL) and surface- initiated polymerization These finetuned architectures are utilized to gu...

Ngày tải lên: 11/09/2015, 10:01

... SURFACE MODIFICATION OF FERROMAGNETIC NANOPARTICLES FOR SEPARATION OF TOXIC HEAVY METALS AND ENVIRONMENTAL APPLICATIONS ZAYED BIN ZAKIR SHAWON B.Sc (Chemical ... cost of separation of detrimental pollutants like heavy metals Recently, scientists have focused on the development of the nanomaterials as adsorbents for the separations of biomolecules,...

Ngày tải lên: 08/09/2015, 19:41

... GENETIC ENGINEERING AND SURFACE MODIFICATION OF BACULOVIRUS DERIVED VECTORS FOR IMPROVED GENE DELIVERY TO THE CENTRAL NERVOUS SYSTEM YANG YI (B Eng.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR ... Chapter Three: Genetic Engineering of Baculovirus Vectors for Controlled Gene Delivery ………65 3.1 Introduction………………………………………………………………… 66 3....

Ngày tải lên: 14/09/2015, 11:28

... Surface Functionalization of Silicon Substrates via SelfAssembled Monolayers 11 2.2 Surface Functionalization via Layer-By-Layer Approach 22 2.3 Surface Functionalization via Grafted Polymer Chains ... processes of RAFT-mediated graft polymerization of VBC on the Si-H surface and functionalization of the VBC graft- polymerized Si surface with viologen...

Ngày tải lên: 16/09/2015, 17:11

... in the HBV genomic sequence in the course of treatment In addition, indirect measures of lamivudine resistance including determination of ALT values, and especially HBV DNA (viral load) assays ... within a broadening and evolving clinical context Moreover, it is increasingly apparent that clinically relevant prediction and monitoring of viral resistance may not only re...

Ngày tải lên: 03/11/2012, 09:41

... contents of the following published and/ or accepted journal and conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications ... predicted the water surface profile and velocity distribution well in simple channels, and the predictions of the model in main channel of compoun...

Ngày tải lên: 06/11/2012, 10:35

... number of Arabidopsis transcripts are potential targets for regulation by the PUF family of proteins The results obtained reveal a molecular conservation of PUF proteins in Arabidopsis thaliana and ... regarding the binding specificity of the subset of group I APUM proteins, showing that A thaliana has at least six PUF proteins with conserved RNA -binding...

Ngày tải lên: 18/02/2014, 06:20

... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...

Ngày tải lên: 18/02/2014, 08:20

... measure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS ... dynamic nature of the nuage Schematic diagram of the preparation of PGCs of medaka specimen (A) OlvasGFP was expressed in the medaka PGC at stage 24 and...

Ngày tải lên: 18/02/2014, 16:20

... the ligand specificity of family carbohydrate- binding modules J Biol Chem 275, 4113 7– 4114 2 30 Accelrys (1993) InsightII v 2.3.0 Accelrys, San Diego, CA Determinants of ligand specificity in CtCBM11 ... grouped into three subfamilies: ‘surface -binding CBMs (type A), ‘glycan-chain -binding CBMs (type B), and ‘small sugar -binding CBMs (type C) [5] Determinants...

Ngày tải lên: 18/02/2014, 17:20

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

... additional amino acid residues are also found in the DNases I of amphibians [19] As in amphibian DNases I, the insertion of an additional amino acid residue into the shark enzymes may be essential ... (snake) and Osteichthyes (carp) enzymes were tested for crossinhibition of activity, all five antibodies were ineffective against the shark DNase I, indicating that, from an i...

Ngày tải lên: 19/02/2014, 16:20

... diacylglycerols of sea urchin Transplantation 74, 261–267 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsukage A, Yoshida S & Sakaguchi K (1998) Studies ... fragrans J Nat Prod 60, 387–389 Sahara H, Hanashima S, Yamazaki T, Takahashi S, Sugawara F, Ohtani S, Ishikawa M, Mizushina Y, Ohta K, Shimozawa K, et al (2002) Anti-tumor effect of chemic...

Ngày tải lên: 19/02/2014, 17:20