Electronic communications mediated by metal clusters and pi conjugated systems 1
... Pt and Pd Centers and Acetylene and Vinylidene iv 4 .1 Introduction 10 3 4.2 Objectives 10 4 4.3 Results and Discussion 10 8 4.3 .1 Syntheses and Structures 10 8 4.3.2 1H and 31P NMR of complexes , and ... into a Kc of 3.3 ± 1. 5 × 10 4 The UV-vis-NIR absorption spectrum of shows an intervalence-charge-transfer band at 11 300 ± 50 cm -1 (εmax = 610 ± 10 M -1 cm -1) ,...
Ngày tải lên: 17/09/2015, 17:17
... Cu(1)-Cu(3)-Cu (2) 59.13 (2) Cu(1)-P(1) 2. 291 (2) Cu(1)-C(1)-Cu (2) 74.8 (2) Cu (2) -P(3) 2. 2861 (2) Cu(1)-C(1)-Cu(3) 69.1 (2) Cu(3)-P(5) 2. 2 828 (2) Cu (2) -C(1)-Cu(3) 72. 9 (2) Cu(1)-C(1) 2. 184(5) Cu(1)-C(3)-Cu (2) 70.8 (2) ... 28 26 24 22 20 18 16 14 12 10 -2 -4 -6 -8 -10 - 12 -14 -16 -18 -20 -22 -24 -26 -28 (ppm) 60 50 40 30 20 10 -10 -20 -30 -40 -50 -60 -70 -80 -90 -100...
Ngày tải lên: 17/09/2015, 17:17
... these two cytokines in < /b> the SP and < /b> attenuated the febrile response in < /b> rabbits (Table 2) Apocynin also inhibited the SEC1-induced nuclear < /b> NF-jB expression (Fig 2C, lanes and < /b> 4) and < /b> its DNA-binding activity ... 48 72 96 Table Effects of NF-jB, PI3K ⁄ Akt, 5-LOX ⁄ FLAP and < /b> NADPH < /b> oxidase < /b> inhibitors on SEC1 induced pyrogenic < /b> cyt...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... expression of CLU or b-actin (E) Cytoplasmic (C) and nuclear (N) extracts isolated from confluent monolayers of HaCaT Neo and HaCaT c-fos cells and total proteins isolated from HaCaT cells and HaCaT cells ... period of days (C) Confluent monolayers of HaCaT Neo and HaCaT c-fos cells were cultured for 24, 48 and 72 h in the presence of serum, and...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganiz...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: A large complex mediated by Moc1, Moc2 and Cpc2 regulates sexual differentiation in fission yeast ppt
... GGATTGAGCAC Moc2- Y GTTTAAACGAGCTCGAATTCATCGATGGGTTAC GTGCATCTGTG Moc2- Z CATGAGCTCAAAGCCTG Moc3 tagging primers Moc3-W CTCGAAGTCATGCTCC Moc3-X GGGGATCCGTCGACCTGCAGCGTACGAAAGTACT GGTCGATTTAAGAC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGAC AAAATCACGC Moc3-Z GCCGTGGTCGGTTCCG Moc4 tagging primers Moc4-W CCTAAGCTGTGCGTTCAATC Moc4-X GGGGATCCGTCGACCTGCAGCGTACGAAGGAGA TTGCTTAATAGTTGCAC Moc4-Y GTTTAAACGAG...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Characterization of recombinant prolidase from Lactococcus lactis – changes in substrate specificity by metal cations, and allosteric behavior of the peptidase pdf
... understanding of the characteristics of this peptidase, which would be of industrial use in the debittering of fermented foods Results and Discussion Cloning and expression of Lc lactis prolidase The prolidase ... protein engineering of this enzyme In the present study, the prolidase- coding gene, pepQ, was isolated from Lactococcus lactis NRRL B-18...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: b-Amyloid protein oligomers induced by metal ions and acid pH are distinct from those generated by slow spontaneous ageing at neutral pH docx
... aged at pH 5.0 at both time points These results indicate that Ab1–40 oligomers generated at pH 7.4 are more toxic to VSMCs than those generated at pH 5.0 Discussion This study demonstrates that ... sodium phosphate buffer in microtitre plate wells Absorbance was monitored at Fig AFM images of aggregates and fibrils of Ab1–40 on HOPG substrate after incubation at...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo y học: "Homocysteine-induced macrophage inflammatory protein-2 production by glomerular mesangial cells is mediated by PI3 Kinase and p38 MAPK" doc
... http://www.journal-inflammation.com/content/6/1/27 L-Cys (100μM) Hcy (50μM) Hcy + LY294002 Hcy + SB203580 Figure Homocysteine-induced MIP- is mediated by p38MAPK and PI3 kinase Homocysteine-induced MIP- is mediated by p38MAPK and PI3 kinase ... Hcy-induced leukocyte cell adhesion to mesangial (A) and by Hcy-induced leukocyte cell adhesion to mesangial cells...
Ngày tải lên: 11/08/2014, 08:22
Anti tumor properties of lactobacilli are mediated by immuno modulation and direct cytotoxicity
... ANTI- TUMOR PROPERTIES OF LACTOBACILLI ARE MEDIATED BY IMMUNO- MODULATION AND DIRECT CYTOTOXICITY CAI SHIRONG B.Sc (Hons), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... the anti- tumor properties of LGG and compare it with that of other lactobacillus strains The study is divided into main areas: I Immuno- modulation by lactobaci...
Ngày tải lên: 11/09/2015, 09:16
Gold bioleaching of electronic scrap material by cyanogenic bacteria and its enhancement with biooxidation
... major types of deposits: gold- quartz lodes and fossil placers Contribution of other deposits is very small Gold usually exists in the form of native gold and electrum (alloy of gold and silver) ... applied in the bio-mining of precious metals from such wastes This project focused on the bioleaching of gold from ESM by cyanogenic bacteria and its enhanc...
Ngày tải lên: 07/10/2015, 10:09
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... PPARc agonist -induced apoptosis [26,27] In the present study, we investigated PPARc agonist -induced adipocyte apoptosis by using 3T3-L1 adipocytes and rat primary adipocytes Adipocyte apoptosis could ... troglitazone -induced adipocyte apoptosis is probably mediated by PPARc, GW9662 should have an inhibitory effect on adipocyte apoptosis As shown in Fig 2B...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
... show that E 2A is involved in fine control of pre-mature B-cell apoptosis mediated by BCR signaling, via transcriptional regulation of survivin, IAP2 and caspase-8 genes Results Insignificant in uence ... BCR signaling and E 2A depletion, mainly via moderate changes in amounts of the inhibitors survivin, IAP2 and ICAD (and probably...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
... hRad51, hRad52 and ssDNA presence of hRad52 renders much better binding of hRad51 to ssDNA even at lower concentrations of the latter, thereby implying that hRad52 plays a role in the recruitment of ... Navadgi et al A Disassembly and recruitment of hRad51 and hRad52 proteins B Fig Aggregation ⁄ disaggregation of hRad51 ⁄ hRad52 proteins vs i...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
... in which the IFN-b gene contained or not the ARE (pIFNHA and pIFNHAAU–) In addition, the sequence encoding the HA epitope was inserted at the end of the IFN-b coding sequence to distinguish the ... containing the hairpin in the 5¢UTR (Fig 4B) Deadenylation of IFN-b mRNA occurs independently of viral infection Fig Deadenylation of IFN-b mRNA is...
Ngày tải lên: 17/03/2014, 10:20