Association study of ABCA1 polymorphisms in singapore populations 6

Association study of ABCA1 polymorphisms in singapore populations 6

Association study of ABCA1 polymorphisms in singapore populations 6

... allele was present at frequencies of 65 % in both Chinese and Indians, and 68 % 129 Chapter Association Study of ABCA1 Polymorphisms in Singapore Populations in Malays, with no significant differences ... Chapter Association Study of ABCA1 Polymorphisms in Singapore Populations 6. 2.2.2 237indelG 237indelG is a one-base insertion/deletion (indel) polym...

Ngày tải lên: 16/09/2015, 17:14

80 170 0
Association study of ABCA1 polymorphisms in singapore populations 5

Association study of ABCA1 polymorphisms in singapore populations 5

... AJ012376 NM 0 055 02 AF1 652 81 AF2 851 67 EST AI802228 AA627178 AI80 753 4 AI 356 194 AI628099 R01 050 R01 051 AA527406 AI 359 714 AA9029 25 AA493786 AI399824 AA731742 AI819 656 R31961 AW 051 752 AA814091 AI6 950 68 AA883989 ... denaturing conditions Primers were designed to amplify most of the 50 exons individually including the entire 5 UTR and the protein coding portion of exon 50...

Ngày tải lên: 16/09/2015, 17:14

50 204 0
Association study of ABCA1 polymorphisms in singapore populations 4

Association study of ABCA1 polymorphisms in singapore populations 4

... aligned using ClustalW 44 Chapter Materials and Methods -515 -49 4U PrU -564T>C -41 7 -40 0U -46 3C>T TSS +1 -40 7G>C -302C>T -278C>G -99G>C -14C>T +280+297L PrL Primers PrU -515 49 4U -41 7 40 0U PrL +280-+297L ... 63 o 56 C 342 107 o 55 C 3 64 142 o 55 C 311 135 o 59 C 333 1 04 o 57 C 44 8 93 o 56 C 43 6 245 o 59 C 41 3 141 52, o 57 C 48 Chapter Materials and Methods 4. 3 Genetic...

Ngày tải lên: 16/09/2015, 17:14

25 211 0
Association study of ABCA1 polymorphisms in singapore populations 3

Association study of ABCA1 polymorphisms in singapore populations 3

... gene-environment interactions are investigated, even larger sample sizes are probably necessary (Ioannidis, 20 03) 3. 6 .3 Chance Findings In a typical association study, each SNP is tested for association in ... required before selecting suitable SNPs for an association study 3. 6.6 Confounding One main drawback of the association study is its potential for confounding...

Ngày tải lên: 16/09/2015, 17:14

16 205 0
Association study of ABCA1 polymorphisms in singapore populations 2

Association study of ABCA1 polymorphisms in singapore populations 2

... that ABCA1 over-expression raises HDL-C (Vaisman et al., 20 01; Singaraja et al., 20 01) Joyce et al (20 02) provided first proof of a direct anti-atherogenic role for ABCA1: expression of human ABCA1 ... phosphatidylethanolamine (Rye et al., 1999) 2. 2 .2 Laboratory Determination of HDL In routine biochemical analysis, HDL in plasma is assayed as the total cholesterol cont...

Ngày tải lên: 16/09/2015, 17:14

18 175 0
Association study of ABCA1 polymorphisms in singapore populations 1

Association study of ABCA1 polymorphisms in singapore populations 1

... normolipidemic Inuits The two major objectives of the dissertation were: Identification of ABCA1 polymorphisms that might be useful in a genetic association study; and Association analysis of ABCA1 SNPs ... contribution of ABCA1 SNPs to inter-individual differences in CAD susceptibility and intermediate phenotype variation, with only Wang et al (2000) reporting an as...

Ngày tải lên: 16/09/2015, 17:14

3 141 0
Mobile labour and worker resistance strategies a study of waste collectors in singapore

Mobile labour and worker resistance strategies a study of waste collectors in singapore

...  political   geography of labour  organising  Space and  spatiality  has  been a  crucial  issue in   the  politics of  organized labour,  tracing  back  to  the  foundations of  American ...  the  increasing  preponderance of  poverty in  many   countries,  especially  those in  Asia and  Africa  Whilst  many  supranational   organizations,  for  example  the  International Labour...

Ngày tải lên: 16/10/2015, 12:00

173 715 0
Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

Báo cáo y học: "Role of STAT4 polymorphisms in systemic lupus erythematosus in a Japanese population: a case-control association study of the STAT1-STAT4 region" pot

... Shimane K, Nakamura Y, Toyama Y, Mochizuki T, Tsukahara S, Kawaguchi Y, Terai C, Hara M, Tomatsu T, Yamanaka H, Horiuchi T, Tao K, Yasutomo K, Hamada D, Yasui N, Inoue H, Itakura M, Okamoto H, Kamatani ... 8:445-455 Kawasaki A, Kyogoku C, Ohashi J, Miyashita R, Hikami K, Kusaoi M, Tokunaga K, Takasaki Y, Hashimoto H, Behrens TW, Tsuchiya N: Association of IRF5 polymorphisms with s...

Ngày tải lên: 09/08/2014, 13:22

9 479 0
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt

Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt

... article as: Minelli et al.: The influence of psychiatric screening in healthy populations selection: a new study and meta-analysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related ... genotyping of both the functional polymorphisms (5-HTTLPR and rs25531) and the haplotypes analysis should be taken into account in...

Ngày tải lên: 11/08/2014, 15:22

12 401 0
A genome wide association study of pulmonary tuberculosis susceptibility in Indonesians doc

A genome wide association study of pulmonary tuberculosis susceptibility in Indonesians doc

... monozygous twins, full siblings, and parent-offspring In each instance, the sample with the higher call-rate was retained in the analysis Analysis of association statistics After sample and SNP quality ... Working Group, Medical Faculty, University of Indonesia, Jakarta, Indonesia 8Samara Oblast Tuberculosis Dispensary, Samara City, Samara, Russian Federation 9Clinical TB and HIV...

Ngày tải lên: 06/03/2014, 04:20

9 504 0
Báo cáo y học: "Association Study of Aromatase Gene (CYP19A1) in Essential Hypertension" ppsx

Báo cáo y học: "Association Study of Aromatase Gene (CYP19A1) in Essential Hypertension" ppsx

... They also have homozygous or compound heterozygous mutations in the CYP19A1 gene Interestingly, male patients with aromatase deficiency exhibit hypertension [19,20] In the present study, the findings ... None of the controls had a family history of hypertension, and they all had SBP and DBP below 130 and 85 mmHg, respectively A family history of hypertension was defined as prio...

Ngày tải lên: 08/08/2014, 16:23

7 378 0
Báo cáo y học: "Association of common polymorphisms in known susceptibility genes with rheumatoid arthritis in a Slovak population using osteoarthritis patients as control" doc

Báo cáo y học: "Association of common polymorphisms in known susceptibility genes with rheumatoid arthritis in a Slovak population using osteoarthritis patients as control" doc

... first study aimed at examining a genetic association in a RA-OA case-control setting in a Slovak population Materials and methods Study participants A total of 520 Slovak individuals (87 males, 433 ... *04 in total as SE [20] With only three alleles in our study population (one in OA controls and two in RA cases), HLA-DRB1*0103 was not used as a separate...

Ngày tải lên: 09/08/2014, 14:20

10 356 0
Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx

Báo cáo khoa hoc:" Study of the impact of perilipin polymorphisms in a French population" docx

... rs4578621 F : CAAGCTGGGTGCACTGGC 185 R : GAGAAATAGAGGAATTAACC rs6496589 F : CTGCCAACACTCG AGCTG 110 R : ACCTGACTCTTCCTTGTCT rs894160 F1 : GCTGAGACTGAGTCACATGC 403 R1 : GCTGAGACTGAGTCACATGC F2 : CTGTTTGTGGGGCTCCCTCG ... et al reported that the A allele was associated with enhanced basal and noradrenaline-induced lipolysis in human subcutaneous fat cells [7], it does not seem to have a...

Ngày tải lên: 11/08/2014, 08:20

6 320 0
báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

... mode of transmission, we evaluated each SNP for association with intrauterine and intrapartum transmission Intrauterine transmission was estimated by infant HIV status at birth Intrapartum transmission ... original institutional review board approval was obtained to ensure the approval of large-scale genotyping of SNPs across the genome Power analysis Power was calculated b...

Ngày tải lên: 11/08/2014, 12:20

11 294 0
w