Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 4

... Rho activation to allow actin nucleation/polymerization associated with Rac and Cdc42 activities This is reflective of the fact that immediate establishment of focal adhesion and spreading was ... heterogeneity Instead, we 133 focused on the functional properties of both CDTa and CDTb and their effects on cellular physiology CDTa exhibited modification of actin monomer...

Ngày tải lên: 16/09/2015, 15:54

25 212 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 5

... Lachumanan, R., Armugam, A. , Durairaj, P., Gopalakrishnakone, P., Tan, C H., and Jeyaseelan, K (1999) In situ hybridization and immunohistochemical analysis of the expression of cardiotoxin and ... C., and Benyamin, Y (2004) Biochemical characterization of the L-plastin -actin interaction shows a resemblance with that of alpha-actinin and allows a distinction to be ma...

Ngày tải lên: 16/09/2015, 15:54

63 401 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 3

... CAGTTGTTATTTTGTACTGACATATCATATAAATACATATTTT -117 -35 -10 TATGATATATAGTTACATATTTTATGAAATTTATATAAAAAAT -74 TCTTATTTAGATTATATAATCTAAATAAATTAAAGTTCAAGAG -31 -35 -10 Start cdtA +1 TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT ... TTAATTAAACTAATATTGGGAGGGAGAATAAATGAAAAAATTT 12 AGGAAACAT TGATGCAACATTGA 138 3 Stop TACCTTAA tattttttcacataaataatttaatatttttcaa Start cdtB atttaaggAGGAGAaaca ATGAAAATACAAATG...

Ngày tải lên: 16/09/2015, 15:54

52 186 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 2

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 2

... CTGGAGATTCAAAATAATAGACATAC R 4 42- 417 AF271719 cdb3 GAACTAATAACTCTCTATCGTCTGG R 4061-4037 AF271719 cdb4 TTGTCTTTATCCAGAAGTTTATCTAC R 1 725 -1700 AF271719 cdb7 ATGTTAAACTTGAAAGAGGAATGA F 324 9- 327 2 AF271719 ... cdb8 GGAGATCCAAATCAGCCTAAAAC F 32- 3954 AF271719 Rcda-For GAAGCAGAAAGAATAGAG F 21 7 -23 4 AF271719 Rcda-Rev ATTAGGTAACAAACCCTCA R 1609-1591 AF271719 Rcdb-For GTGGGAAGATAGTTTTGC F 7...

Ngày tải lên: 16/09/2015, 15:54

61 289 0
Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 1

Cytophysiologic effects and molecular inhibition of a functional actin specific ADP ribosyltransferase CDT from clostridium difficile 1

... 3 .10 Protein profiles and autoradiograms showing ADP- ribosylated actin by various CDTa isoforms and NAD photolabeled CDTa 81 3 .11 Proposed mechanism of ADP- ribosylation of actin by ADPRT ... antibiotic-associated diarrhea ADP adenosine diphosphate ATP adenosine triphosphate ADPRT ADP- ribosyltransferase ARTase ADP- ribosylation assay amp ampicillin bp base pairs BHI b...

Ngày tải lên: 16/09/2015, 15:54

13 244 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature...

Ngày tải lên: 08/03/2014, 08:20

13 492 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx

... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 200...

Ngày tải lên: 07/03/2014, 15:20

11 703 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf

... were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six ... 35 Kawase T, Yokokawa S, Saito A, Fujii T, Nikaidou N, Miyashita K & Watanabe T (2006) Comparison of enzymatic and antifungal properties between family 18 and 19 chitinas...

Ngày tải lên: 07/03/2014, 11:20

12 400 0
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc

... Fe-containing catalytic subunit of CO dehydrogenase A catalytically active CooSI dimer has been previously purified and characterized from C hydrogenoformans [25] The 89- and 62-kDa polypeptides were assigned ... enzyme complex from Carboxydothermus hydrogenoformans After cell breakage and separation of the membrane fraction from the soluble fraction, 80–90% of...

Ngày tải lên: 23/03/2014, 21:20

10 377 0
Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection ... infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed infection Mixed...

Ngày tải lên: 12/08/2014, 16:20

10 403 0
Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation

Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation

... AMF ASEAN Maritime Forum eAMF Expanded ASEAN Maritime Forum AMMTC ASEAN Ministerial Meetings on Transnational Crime APSC ASEAN Political -Security Community APT ASEAN plus Three (ASEAN +3) ARF ASEAN ... China Sea In addition, sea piracy in Southeast Asian waters remains a modern-day issue, hardly an antiquated concern of the past The timeliness and magnitude...

Ngày tải lên: 30/09/2015, 10:12

129 531 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian s...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx

Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx

... Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population Conflict and Health 2010 4:16 Submit your next manuscript ... physical functioning and activity, participation in social life and environmental factors was obtained in further interviews u...

Ngày tải lên: 13/08/2014, 14:20

13 321 0
Từ khóa:
w