Identification and characterization of proteins that interact with zonula occludens proteins
Identification and characterization of proteins that interact with zonula occludens proteins
... IDENTIFICATION AND CHARACTERIZATION OF PROTEINS THAT INTERACT WITH ZONULA OCCLUDENS PROTEINS P JAYA KAUSALYA (B.Sc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... in TJ that are part of MAGUK family Fig 13: Structure of PDZ3 domain of PSD-95 with a peptide ligand Fig 14: Possible modes of interaction of PDZ containing proteins Fig 15: ZO-3 interacts with ... ZO-1, -2 and -3 to the actin cytoskeleton This study identifies the roles of zonula occludens (ZO) proteins and characterizes their interacting partners Novel proteins that interact with ZO-1...
- 223
- 378
- 0
Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides
... Bibliography 195 Appendix 224 Publications 238 vi Summary Identification and characterization of novel proteins from a rare Australian elapid snake Drysdalia coronoides Partial transcriptome from ... venomous terrestrial snakes of the Elapidae family have undergone an extensive radiation in Australia [12] Elapid snake genus Drysdalia from southern Australia is a group of rare snakes comprising ... islands of Ireland, Iceland and New Zealand [5, 6] They have successfully colonized various habitats and feed on small animals including lizards, snakes, rodents, small mammals, birds, eggs and...
- 268
- 406
- 0
Identification and characterization of svp interacting proteins of short vegetative phase in arabidopsis thaliana
... function of most of the J-domain proteins remains to be elucidated The function of several known J-domain proteins will be discussed in detail in section 1.5 29 1.5 Function of J-domain proteins during ... J-domain proteins in the Arabidopsis genome (Rajan and D'Silva, 2009) These J-domain proteins are classified into four distinct groups Type I J-domain proteins have all of the four domains organized ... proteins 26 1.4.1 Heat shock proteins in plants 26 1.4.2 Hsp40 27 1.4.2.1 General features of Hsp40 27 ii 1.4.2.2 J-domain proteins in Arabidopsis 1.5 Function of J-domain proteins during Arabidopsis...
- 216
- 335
- 0
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant
... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCTTCAAACAAGTAATG ... GGATCCCGGCGAATGATTATGAGA 3' CGCCCAAAGAGGTTTATG 3' ScAFT1 deletion AFT1 ABf: 5' TGAAGTATAAACCGCTAC 3' 28 Chapter Materials and methods AFT1 ABr: AFT1 CDf: AFT1 CDr: 5' GGATCCAGATGAATCAAATTGTTT 3' 5' GGATCCGGAAGAGTGGGATCGG...
- 124
- 400
- 0
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf
... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay described by Holmgren ... by the interaction of thioredoxin and thioredoxin peroxidases [20] Therefore, the study of the thioredoxin system in aerobic hyperthermophilic archaea should be informative There is no study...
- 8
- 414
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
- 24
- 604
- 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx
... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatosis and metastases in ... found in both normal ovarian epithelium and human ovarian carcinoma [40,41] Interleukin-18 (IL-18) is a proinflammatory cytokine that stimulates interferon-g production Ovarian carcinoma expresses...
- 8
- 440
- 0
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine protease subfamily S8A Expression of ... stearothermophilus protease promoter Protease promoter represents the predicted alkaline serine protease promoter region E coli protease promoter represents, E.coli lon protease promoter Effect of pH and temperature...
- 10
- 426
- 0
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps
... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action of the Hh agonists, we predict that ... binding of the Hh agonist to Smoexpressing cells This supports the model that all of these small-molecule modulators of Hh signaling are direct ligands of Smo We next asked whether a derivative of...
- 19
- 322
- 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS participated in the analysis and interpretation ... of data and helped to draft the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the design of...
- 8
- 550
- 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx
... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining layer completely devoid of ... synovial lining layer and perivascular regions of RA (OCT section) tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating...
- 9
- 489
- 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM 26 soluble Figure The CaNDR1a protein is enriched in plasma ... enhanced disease resistance to the DC3000 strain, as previously reported Cacas et al BMC Plant Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 Page of 17 Figure The CaNDR1a protein...
- 17
- 455
- 0
Từ khóa: cloning expression purification and immunological characterization of proteins encoded by regions of difference genes of mycobacterium tuberculosisidentification filtering and characterization of single nucleotide variantsexpression purification and characterization of hiv 1 in proteinsthermal oxide synthesis and characterization of fe3o4nanorods and fe2o3 nanowiresisolation and characterization of vascular endothelial cells from murine heart and lungisolation and characterization of embryonic and adult epicardium and epicardium derived cellsfor the receipt and acceptance of the assets supplied with a debit to accounts in group 2studies on growth crystal structure and characterization of novel organic nicotinium trifluoroanumber and percentage of title iv institutions with imputed 1 year retention rates for first time degree certificate seeking undergraduate students by control degree granting status and attendance status united states fall 2010areas of private water supply with consumptive water use and areas of public water supply with septic system return flow in the assabet river basin eastern massachusettsanalysis and discussion of variables that relate the overall shaft performance during the swingpreparation and characterization of nanostructured tio2 thin films by hydrothermal and anodizaticontractors—identification and recoupment of improper and potentially fraudulent payments and cms s oversight and responsecollection screening and characterization of microalgaecollection screening and characterization of microalgae by seri in house researchersNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ