Analysis of ethylene receptor genes from petunia and arabidopsis

... compensation of these two classes of receptor genes is suggested by both absence of phenotype in single loss -of- functions mutant of Arabidopsis and also from the antisense suppression studies of tomato ... Expression analysis of PERS1 and PETR2 in different stages of leaf and flower development To get a detailed understanding of the expression pattern of PE...

Ngày tải lên: 15/09/2015, 22:05

... al.: Expression analysis of asthma candidate genes during human and murine lung development Respiratory Research 2011 12:86 Submit your next manuscript to BioMed Central and take full advantage of: ... RORA and HLA-G showing the most consistent expression patterns across human and mouse Table Gene expression analysis of specific asthma genes and ev...

Ngày tải lên: 12/08/2014, 13:22

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

... variability in azimuth of the gap fraction A sharper analysis (K and K leads to a ) 22 45 smaller but non-negligible increase in K 3.4 Leaf area index estimation TableI presents estimates of leaf ... the gap fraction at various zenith angles, measured in the two plots with the PCA (n 10) and hemispherical photographs (n 4) Data from the PCA show a regular...

Ngày tải lên: 08/08/2014, 14:21

... dTGGGGAGGACAGGGAGAT IIB-UTRSR dATCACTTTTAATGTGCTGGTAGAGG 63 PCR1 dGGAGAAACCATCATGCTGAG 4INM dCAATTTTGCTGCTATGGGC 52 IIA-R dAATCCCAGAAATTCTCCCG IIA-H dAATCCCAGAAATTCTCCCA IIIB-NA1F dCAGTGGTTTCACAATGTGAA ... Conversely, FcγRIIb contains an inhibitory motif in the cytoplasmic tail and abrogates cellular activation FcγRIIb may also play a role in maintaining peripheral B cell tolerance an...

Ngày tải lên: 09/08/2014, 07:20

... in the expression and binding of GRs in SS patients compared with those in controls except for the binding of GR in T lymphocytes Similar results were also found in patients with nephrotic syndrome ... specificity of staining in FCM was established by using non-specific mouse IgG1 and unlabelled Dex Additionally, to evaluate the reproducibility of FCM an...

Ngày tải lên: 09/08/2014, 14:22

... [53] The closest free-living taxa to the Strongylida are members of the Rhabditina, including C elegans, and both are grouped in Clade V of the Nematoda, on the basis of small subunit rRNA sequence ... existing entries), using a cutoff score of 80 in BLASTX (P < e-10) The number of ESTs bearing potential signal sequences was then calculated and the results...

Ngày tải lên: 09/08/2014, 20:20

... doi:10.1186/1471-2229-11-167 Cite this article as: Mahomed and van den Berg: EST sequencing and gene expression profiling of defence-related genes from Persea americana infected with Phytophthora cinnamomi BMC Plant Biology ... pathogenesis-related protein, a mlo transmembrane protein and profilin Nine genes were quantified with qRT-PCR to elucidate the ear...

Ngày tải lên: 11/08/2014, 11:21

... 18 4 3 2 10 1 1 1 1 2 2 1 22 12 17 10 Subgenus Betulenta: B lenta 10 6 3 4 1 - - 1 14 11 10 3 10 2 10 3 10 6 - - 4 4 - 2 3 5 - 3 2 - 1 1 2 2 - 1 1 - - - - 20 16 20 17 - 17 11 12 11 13 Subgenus Betula: ... 17 % - Isoform Gene 01A 01 1A Ia: n.q IIIa: 51 IVa: 10 0 Va: 46 VIIa: 75 01A06 1A Ia: n.q IIIa: 51 IVa: 10 0 Vb: 23 VIIa: 75 01B 01 1B Ib: 69 IIIb: 1...

Ngày tải lên: 12/08/2014, 03:20

... Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; ... glycinebetaine synthesis even in the plants not accumulating glycinebetaine naturally, like Arabidopsis thaliana, Brassica napus and Nicotiana tobacum [98] Moreover, modelling...

Ngày tải lên: 12/08/2014, 03:20

... this article as: Altenbach et al.: Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protei...

Ngày tải lên: 12/08/2014, 03:21

... lack of activation and expression of CD38 and HLA-DR on CD4+ T cells correlates with long-term non-progression [9] The enumeration of CD4+ T- lymphocytes by flow cytometry is used routinely in the ... infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those from...

Ngày tải lên: 13/08/2014, 05:22

... sequenced, assembled and analyzed for repeat and gene content Manual gene annotations were compared to the Ae aegypti, A gambiae and D melanogaster gene sets A subset of these annotations had their ... validated with molecular and comparative data In addition, we have presented data that may clarify the origin of duplicated transcripts in the genome assembly BAC a...

Ngày tải lên: 14/08/2014, 07:21

... expression analysis for diurnally regulated genes To gain insights into the tissue specificity of expression levels of diurnally regulated genes, we next examined their expression levels in the ... studies By identifying a large number of diurnally regulated genes in a defined brain region, a clustering analysis resulted in sufficiently large number...

Ngày tải lên: 14/08/2014, 08:20