Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci 1

Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci 1

Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci 1

... …………………………………………………………………… 14 1 iii Genetic Characterization of Nucleotide Analogue Transporters ABCC4 and ABCC5 Gene Loci 10 .2 A rapidly declining LD profile of ABCC4 14 2 10 .3 Population-specific ... ……………………………… 92 Chapter Genetic characterization of ABCC4 gene locus ……………… 95 ii Genetic Characterization of Nucleotide Analogue Transporters...

Ngày tải lên: 15/09/2015, 21:28

14 356 0
Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci

Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci

... samples and Sew Pui Hoon who assisted in the genotyping of ABCC5 Wang Baoshuang and Ren Jianwei gave generously of their time to guide me and I benefited from their expertise in cloning I must ... initially written and modified by Tang Kun, with assistance from Wang Zihua and Wang Jingbo Thanks must also go to Ngoi Soo Mun who was involved in the DNA extraction of blood samp...

Ngày tải lên: 15/09/2015, 21:28

2 226 0
Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci 3

Genetic characterization of nucleoside analogue transporters ABCC4 and ABCC5 gene loci 3

... ABCC5 ABCC6 ABCC1 ABCC2 ABCC3 ABCC4 ABCC5 ABCC6 1 531 aa 1545 aa 1527 aa 132 5 aa 1 438 aa 15 03 aa 48.4 57.6 39 .4 35 .8 45.0 46.8 36 .8 36 .2 39 .1 35 .3 33. 1 43. 6 36 .5 33 .9 30 .9 - Table Overall amino ... cytarabine, and fludarabine in HEK2 93 cells overexpressing either ABCC4 or ABCC5 (Reid et al 2003a) Whereas 35 Genetic Characterization of Nucleotide...

Ngày tải lên: 16/09/2015, 08:30

190 139 0
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

... examine the effect of the APOH promoter SNPs on plasma b2GPI levels; and (d) to determine the cross-species conservation of the APOH promoter sequence To identify regions of the APOH promoter that ... quantitative change at the protein level Whether the APOH promoter SNPs ()643T>C and )1219G>A) could influence the promoter activity by either the former or...

Ngày tải lên: 15/03/2014, 10:20

13 404 0
Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and functio...

Ngày tải lên: 30/03/2014, 03:20

8 496 1
Báo cáo sinh học: " Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" pdf

Báo cáo sinh học: " Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" pdf

... showing province and number of measles virus isolates obtained during 2000- 2001 Figure virus isolates obtained during 2000 2001 Map of Turkey showing province and number of measles Map of Turkey ... COBL COBL COBL urine urine urine urine urine urine urine throat swab urine urine throat swab nasal swab urine urine urine urine throat swab urine urine urine blood blood...

Ngày tải lên: 19/06/2014, 08:20

5 390 0
báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx

báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx

... showing province and number of measles virus isolates obtained during 2000- 2001 Figure virus isolates obtained during 2000 2001 Map of Turkey showing province and number of measles Map of Turkey ... COBL COBL COBL urine urine urine urine urine urine urine throat swab urine urine throat swab nasal swab urine urine urine urine throat swab urine urine urine blood blood...

Ngày tải lên: 20/06/2014, 04:20

5 503 0
Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc

Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc

... for the characteristics of the PanAsia strains isolated from China (as detailed in Results & Discussion) Here, we first report the cell-adapted PanAsia strain (O/Fujian/CHA/5/99) of FMDV isolated ... 2) By using the atomic coordinates obtained by X-ray crystallography of FMDV O BFS, six mutations which are clustered the position occupied by the G-H loop of VP...

Ngày tải lên: 12/08/2014, 01:21

11 383 0
Báo cáo y học: "Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" pptx

Báo cáo y học: "Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" pptx

... be involved in the induction of apoptosis, including the 7a and 7b proteins [18,46,47] To analyze whether the deletion in ORF 7b had any influence on its Amino acid variability in ORF 7b and ... overexpression of ORF 7a, ORF interferon induction the Influence on apoptosis and type I 7b, and ORF 7b with by Influence on apoptosis and type I interferon indu...

Ngày tải lên: 12/08/2014, 04:20

17 286 0
Báo cáo khoa học: " Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" docx

Báo cáo khoa học: " Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" docx

... apoptosis, including the 7a and 7b proteins [18,46,47] To analyze whether the deletion in ORF 7b had any influence on its Amino acid variability in ORF 7b and RT-PCR analysis of ORF 7b in clinical ... sequences in GenBank (except in an independent sequence of the Frankfurt strain) , and in none of SARSlike bat-CoV sequenced in the ORF 7b region...

Ngày tải lên: 12/08/2014, 04:20

17 347 0
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing

... breakdown of lignocellulosic biomass for the establishment of a robust and cost-efficient process for production of cellulosic ethanol Acknowledgements Financial support by the Center for Bioprocessing ... thermophilic consortia for cellulase and xylanase production [7, 27] These reports, however, lack information on the biochemical and kinetic properties of the...

Ngày tải lên: 05/09/2013, 16:11

14 526 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
Báo cáo khóa học: Characterization of presenilin complexes from mouse and human brain using Blue Native gel electrophoresis reveals high expression in embryonic brain and minimal change in complex mobility with pathogenic presenilin mutations pptx

Báo cáo khóa học: Characterization of presenilin complexes from mouse and human brain using Blue Native gel electrophoresis reveals high expression in embryonic brain and minimal change in complex mobility with pathogenic presenilin mutations pptx

... complex from carbonatewashed membranes of SY5Y and 5-day-old mouse brain were examined using 10% Tris/tricine gels with reducing Ó FEBS 2003 Analysis of mouse and human brain presenilin complex ... assembly and stabilization of the complex [50–52] High levels of PS complex were detected in mouse embryonic brain consistent with high expres...

Ngày tải lên: 16/03/2014, 16:20

11 488 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

... downstream from His80 in the vicinity of the zinc center and is assumed to clamp the imidazolium ring of His80 Glu149 is in the immediate vicinity of the Glu150 of the zinc center and is assumed ... present the cloning and expression of the V alginolyticus pepD gene, the purification and biochemical characterization of the produced PepD recombina...

Ngày tải lên: 23/03/2014, 06:20

14 304 0
w