Abstract construal of top leaders respect as a mediator

... perception of a leader is matched against an abstract prototype of a leader and this prototype is more equivalent to a high-level construal category (or abstract category) as in the case of topboss (Cantor ... leaders (top- boss) had high or more abstract construal Preliminary Analyses I coded the responses to the categorical variables of abstract or high constr...

Ngày tải lên: 15/09/2015, 21:09

... interest students in listening lessons That is the reason why this paper is made a study of using English songs as a kind of supplementary material in teaching listening skill to first year non- major ... OF USING SONGS AS A SUPPLEMENTARY MATERIAL IN TEACHING LISTENING FOR THE FIRST- YEAR NON- MAJOR STUDENTS OF ENGLISH...

Ngày tải lên: 29/01/2014, 10:33

... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... underlying the case study itself is of a holistic nature Case studies may either focus on a single case or use a number of cases: A single case may...

Ngày tải lên: 20/02/2014, 11:20

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGG...

Ngày tải lên: 06/03/2014, 22:21

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is...

Ngày tải lên: 07/03/2014, 10:20

... types of costing method such as: traditional or absorption costing method, variable costing method, throughput costing method, and ABC costing method Changes in business environments requires a better ... variable costing method was used as the only and easiest way to calculate the costs This is because it is easy to accountants as well as managers and...

Ngày tải lên: 13/03/2014, 14:19

... signalregulated kinase ⁄ (ERK1 ⁄ 2) and protein kinase B (PKB) pathways that act downstream of oncogenic protein kinases [10,11] It is increasingly apparent that BIM as a mediator of tumour cell ... a potent inhibitor of mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase kinase ⁄ kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacody...

Ngày tải lên: 16/03/2014, 00:20

... Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae ... glaucophyte, C paradoxa that has the most primitive plastids [23], contained the PsbV and PsbU proteins as the extrinsic proteins (Figs and 2) A primitive red alga, C caldarium th...

Ngày tải lên: 23/03/2014, 15:21

... pain, and emotion are the same as in Table The indirect effect of having a chronic condition versus no chronic condition as mediated by physical activity Percentage of the total effect of having ... represent the views of Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another...

Ngày tải lên: 18/06/2014, 22:20

... brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful tool for assessing health status among young military members Self-rated health ... health behaviors (e.g., tobacco, alcohol and drunk driving habits) to examine the validity of self-rated overall health as a measure of health...

Ngày tải lên: 20/06/2014, 15:20

Ngày tải lên: 21/06/2014, 04:20

... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... reduction Characterization of Gold Nanotriangles Experimental Details Isolation of Endophytic Aspergillus clavatus The host plant Azadirachta indica...

Ngày tải lên: 21/06/2014, 08:20

... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni .....

Ngày tải lên: 07/08/2014, 18:21

... osteosarcoma cells Ant Embryol (Berl) 19 92, 186 :27 1-4 doi: 10.1186/147 7-7 81 9-8 -3 8 Cite this article as: Cheung et al., Bony metastases from breast cancer - a study of foetal antigen as a blood tumour marker ... bony metastases These preliminary data point out that FA -2 is a potential helpful blood marker for bony metastases from breas...

Ngày tải lên: 09/08/2014, 03:21