Functional studies of a type III and a novel secretion system of edwardsiella tarda

... such as Escherichia coli, Salmonella, Shigella, and Yersinia species E tarda is a relatively new genus, and the first report about the genus of Edwardsiella was in Japan by Sakazaki and Murata (1962) ... bromo-4-chloro-3-indolyl-β-D-galactopyranoside xv SUMMARY Edwardsiella tarda is an opportunistic gram-negative bacterial pathogen affecting both animals and humans The abi...

Ngày tải lên: 15/09/2015, 17:11

Ngày tải lên: 10/09/2015, 15:48

... Dr Asha, Dr Huang Canhua, Dr Wu Jinlu, Ms Tang Xuhua, Ms Sunita and, Mr Jobi and the rest of the lab mates for the valuable discussion and friendship and the present and former members of Functional ... Birnaviridae, Bunyaviridae, Herpesviridae, Piconaviridae, Parvoviridae, Reoviridae, Rhabdoviridae, Togaviridae, Iridoviridae, Nodaviridae and Nimaviridae Crustacean viral dise...

Ngày tải lên: 14/09/2015, 09:57

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... and phycocyanins, HPLC separation allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak This was facilitated by the fact that the ... region rich in amino acids with a higher than average contribution to the UV optical absorption and protonation of amino groups by electrospray ionization, leading to fals...

Ngày tải lên: 08/03/2014, 16:20

... I Secretion System 1.6 Type II Secretion System 10 1.7 Type III Secretion System 12 1.8 Type IV Secretion System 26 1.9 Type V Secretion System 27 1.10 Type VI Secretion System 29 1.11 Aim of ... Island Figure: Type I–V secretion systems in Gram-negative bacteria Figure: 1.3 Model of pilus-mediated secretion via the type II secretion system 11...

Ngày tải lên: 14/09/2015, 14:13

... and ARAP3 (Krugmann et al., 2002; Miura et al., 2002) All these three ARAP contain five PH domains, an ArfGAP domain and a RhoGAP domain (Miura et al., 2002) ARAP1 and ARAP3 have equal GAP activity ... Sekimata et al., 1999) PSGAP, a protein that interacts with PYK2 and FAD and contains multiple domains including a pleckstrin homology (PH) domain, a RhoGAP- activating prote...

Ngày tải lên: 17/09/2015, 17:20

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... catalytic residues: E52 and R105 It is evident from the kinetic results that mutation of E52 changes only the catalytic rate For the E52D mutant the Km value was approximately the same as for the wild-type ... mutation of deoxyribonucleoside kinase L Egeblad-Welin et al Human deoxyribonucleoside kinases are targets for the chemotherapeutic treatment of...

Ngày tải lên: 19/02/2014, 02:20

... has already established Of two possible dimeric structures of LPL, the head-tohead and the head-to-tail models, the studies of the chimeric proteins of hepatic lipase and LPL and the tandem repeat ... (Fig 4A and B, 5) The lipase activity of the K413A mutant is similar to that of wild type LPL, whereas the esterase activity is reduced to 60% of t...

Ngày tải lên: 21/02/2014, 15:20

... Hemolymph titers of PO -CHH and ES -CHH in response to changes in dissolved oxygen Hypoxia induced the release of CHHs from the PO and ES of the juvenile crabs (Fig 6) At the initial control normoxic ... of CHH cDNA from the ES [28] Also, we examined the physiological responses of the release and expression of these two CHHs under stressful co...

Ngày tải lên: 16/03/2014, 06:20

... rans phil us Vibrio cholerae Escherichia coli Rickettsia prowazekii Sulfolobus acidocaldarius Aquifex aeolicus Helicobacter pylori B ac Prokaryotic Family I sPPases * Neisseria meningitidis 925 ... (MDLSRIPPQP KAGILNVLIE IPAG), and Rhodop viridis (MRIDA IDXA), and that of Mi aeruginosa NIES-44 (MDL SRKPAQP IPGLKNVLVE TAGSINIT) [16], show a high degree of similarity with other cyto...

Ngày tải lên: 16/03/2014, 11:20

Ngày tải lên: 14/11/2014, 08:21

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... the DAVID Functional Classification Tool Additional data file provides graphical instruction and a tutorial on how to use the DAVID Functional Classification Tool and the DAVID Functional Annotation ... randomization will matrixkappa suggest to Classificationby on annotationcompared by GENECODIS the novel examples analytical genes; for and chical inflammatory and shows...

Ngày tải lên: 14/08/2014, 08:20