Functional prediction of bioactive toxins in scorpion venom through bioinformatics
... V Functional prediction of bioactive toxins in scorpion venom through bioinformatics Summary Scorpions are venomous animals that produce a myriad of important bioactive toxins that are used in ... function of toxins 20 II Functional prediction of bioactive toxins in scorpion venom through bioinformatics Chapter summary 22 Part II: Chapter Cl...
Ngày tải lên: 15/09/2015, 17:10
... in each window session RESULTS AND DISCUSSIONS Simulation of atrazine fate, leaching and runoff loss As atrazine load into the RBS and the runoff depth from the cornfield increased the atrazine ... only provides inputs to the rest of the model that there is a crop growing Simulation of atrazine transport The focus of this simulation was on the movement of...
Ngày tải lên: 05/09/2013, 09:08
... predicting salts transport in fields in China The objective of this study was to examine the change in hydraulic conductivity that occurs as a result of adding the gypsum, and to examine the transport ... the beginning of leaching, decreased after a peak, and then increased and decreased again This behavior indicates that the initial leaching is like Na+ leachi...
Ngày tải lên: 05/09/2013, 09:38
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Prediction of Learning Curves in Machine Translation" ppt
... distinct combinations of language-pair and domain, each with fourteen distinct training sets of increasing size and tested these instances on multiple in- domain datasets, generating 96 learning curves ... a Machine Learning context, Perlich et al (2003) used learning curves for predicting maximum performance bounds of learning algorithms and to compare them In Gu et al...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACA...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo lâm nghiệp: "Study of the properties of thirteen tropical wood species to improve the prediction of cutting forces in mode B" pptx
... DISCUSSIONS The aim of this study is to improve the relation that allowed calculating cutting forces involved during machining, and to take into account, more precisely, the influence of wood material in ... crack propagation in the wood cutting process influences either the quality of the chip in veneer cutting, or the quality of the residual su...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo khoa học: "Prediction of acorn crops in three species of North American oaks: Quercus alba, Q rubra and Q velutina" docx
... predict acorn crops in Missouri oad species, white oak (Quercus alba L), northern red oak (Q rubra) and black oak (Q velutina) We summarize herein the results of a prior study that examined internal ... internal and external factors which influence the size of acorn crops in these species (Sork et al, in press) and we present additional results to illustrate the...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: " Prediction of clinical toxicity in localized cervical carcinoma by radio-induced apoptosis study in peripheral blood lymphocytes (PBLs)" pot
... radiosensitivity, showed abscense of induction of p53 [18,19] and Figure and 72 hours Radio-induced apoptosis (RIA) of lymphocytes after 24, 48 Radio-induced apoptosis (RIA) of lymphocytes after 24, 48 ... buffer Cells were incubated with μl of annexin V-FITC and 10 μl of propidium iodide (PI) for 15 minutes at room temperature in the dark Finally, 400 μl of 1× ann...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo khoa học: " Prediction of clinical toxicity in locally advanced head and neck cancer patients by radio-induced apoptosis in peripheral blood lymphocytes (PBLs)" ppt
... this article as: Bordón et al.: Prediction of clinical toxicity in locally advanced head and neck cancer patients by radio-induced apoptosis in peripheral blood lymphocytes (PBLs) Radiation Oncology ... Hernandez LA, Lara PC, Pinar B, Fontes F, Rodriguez Gallego C, Lloret M: Prediction of clinical toxicity in localized cervical carcinoma by r...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo sinh học: "Prediction of genetic gains in body weight, egg production and shell quality traits in the Brown Tsaiya laying duck" pps
... traits in laying female ducks Recently, Besbes (1993) estimated the genetic trends in two strains of laying hens selected for egg production, egg quality and body weight traits, by the regression of ... especially in G5 with larger change of climate in the open feeding system (it was 217 eggs in G6) On the other hand, the increase in inbreeding...
Ngày tải lên: 09/08/2014, 18:22
báo cáo khoa học: " Multi-drug resistance 1 genetic polymorphism and prediction of chemotherapy response in Hodgkin’s " pot
... Median 31 27.5 15 -20 16 (16 .7) 17 (50) 21- 30 31- 40 32 (33.3) 18 (18 .8) (14 .7) (14 .7) > 40 30 ( 31. 2) (20.6) Males 50 (52 .1) 21 ( 61. 8) Females 46 (47.9) 13 (38.2) Early stages (I &II) 41 (42.7) ... Mhaidat et al.: Multi-drug resistance genetic polymorphism and prediction of chemotherapy response in Hodgkin’s Lymphoma Journal of Experimental & Clinical...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: "The role of Qa-2, the functional homolog of HLA-G, in a Behcet''''s disease-like mouse model induced by the herpes virus simplex" pptx
... Leader peptide domain 5'-CAACACUCGCAAUAUU-3'(sense) 3'-GUUGUGAGCGACGUUAUAA-5'(antisense) α3 domain 5'-AGGUCUUAUGGUGCUGUCAUU-3'(sense) 3'-UUUCCAGAAUACCACGACAGU5'(antisense) Transmembrane domain ... Qa-2 domains for 24 hrs, and the expression of Qa-2 was then determined by reverse transcriptase-PCR and FACS analysis Lanes 4, and (α3 domain, transmembrane domain, and cytoplasmic domain, re...
Ngày tải lên: 11/08/2014, 03:20