Sterol rich membrane domains and membrane associated proteins in the fission yeast schizosaccharomyces pombe

Sterol rich membrane domains and membrane associated proteins in the fission yeast schizosaccharomyces pombe

Sterol rich membrane domains and membrane associated proteins in the fission yeast schizosaccharomyces pombe

... of sterol- rich membrane domains suggests multiple roles for sterols in polarity and/ or growth on one hand and in cytokinesis on the other hand To gain insight into the possible functions of sterols ... enzymes and ligation of fragments into vectors (Ausubel, 2005) 20 Sterol- rich membrane domains in the fission yeast Schizosaccharomyces pombe 3.1 Detec...

Ngày tải lên: 15/09/2015, 17:09

186 262 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... 2675 Actin and ABPs in transcription regulation B Zheng et al Table Role of nuclear actin- binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain ... STARS-interacting proteins These novel proteins contain four LIM domains and a C-terminal villin headpiece domain, which mediates actin- binding in several proteins,...

Ngày tải lên: 07/03/2014, 01:20

17 574 0
Báo cáo y học: " Antagonistic interaction of HIV-1 Vpr with Hsf-mediated cellular heat shock response and Hsp16 in fission yeast (Schizosaccharomyces pombe)" potx

Báo cáo y học: " Antagonistic interaction of HIV-1 Vpr with Hsf-mediated cellular heat shock response and Hsp16 in fission yeast (Schizosaccharomyces pombe)" potx

... a dynamic interaction between vpr gene expression and activation of Hsp16 in fission yeast Results of our parallel studies in mammalian cells indicated a similar dynamic and antagonistic interaction ... Yu M, Chen M, Edelson S, Zhao Y: Cell cycle G2 arrest induced by HIV-1 Vpr in fission yeast (Schizosaccharomyces pombe) is independent of cell death...

Ngày tải lên: 13/08/2014, 09:20

14 229 0
Triacylglycerol synthesis and stress response in fission yeast schizosaccharomyces pombe

Triacylglycerol synthesis and stress response in fission yeast schizosaccharomyces pombe

... cerevisiae S pombe Schizosaccharomyces pombe SAPK stress- activated protein kinase SREBP sterol regulatory element-binding protein Sty1p suppressor of tyrosine kinase protein TAG triacylglycerols ... group of biogenic amines that are neural transmitters, and include dopamine, norepinephrine and epinephrine (adrenaline) and glucagon are important inducers of lipolysis and HSL is...

Ngày tải lên: 16/09/2015, 15:55

247 260 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx

... CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC ... had variable symptoms (Y33 0A, C33 5A, D36 3A, and P39 9A) All four of the mutations were stably maintained For example the alanine residue is maintained for Y33 0A cDNA re-i...

Ngày tải lên: 19/06/2014, 08:20

12 307 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... et al MT1-MMP and furin can interact with GRASP55 Overexpression of GRASP55 has been found to increase the amount of complex containing MT1MMP and furin, and the expression of a catalytically inactive ... with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane c...

Ngày tải lên: 18/02/2014, 04:20

18 603 0
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... the most reliable means of purifying integral membrane proteins from the mitochondrial outer membrane, and of the 11 most abundant integral proteins, 10 had a-helical transmembrane segments Of ... the proteins of the outer membrane, we set out to determine what proportion was integral and to identify the major protein species To determine whether the...

Ngày tải lên: 19/02/2014, 07:20

9 554 0
Báo cáo y học: "Comparative analysis of Saccharomyces cerevisiae WW domains and their interacting proteins" pps

Báo cáo y học: "Comparative analysis of Saccharomyces cerevisiae WW domains and their interacting proteins" pps

... affinity (lower KDapp) WW WW WW WW (c) X WW WW Figure for protein ligands A model10 the optimization of interactions between WW domains and A model for the optimization of interactions between WW domains ... suggesting that WW domains have sufficient recognition malleability to bind structurally similar peptide ligands within the PY (PPxY) and LPxY ligand classes Bot...

Ngày tải lên: 14/08/2014, 16:21

15 234 0
Computational study of therapeutic targets and ADME associated proteins and application in drug design

Computational study of therapeutic targets and ADME associated proteins and application in drug design

... process of drug discovery - VI - Computational study of therapeutic targets and ADME- associated proteins and application in drug design List of Tables LIST OF TABLES Table 1-1: A brief history of ... pharmacogenetic prediction of drug responses 159 - VII - Computational study of therapeutic targets and ADME- associated proteins and...

Ngày tải lên: 15/09/2015, 22:19

187 1,1K 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

... FEBS BMP/ activin pathway in Crassostrea gigas bivalve mollusc Crassotrea gigas, we report the cloning and functional study of the central part of the BMP pathway (the Cg-BMPR1 type I receptor and ... transmembrane domain and the serine ⁄ threonine kinase domain FEBS Journal 272 (2005) 3424–3440 ª 2005 FEBS 3427 BMP/ activin pathway in Crassostrea...

Ngày tải lên: 07/03/2014, 21:20

17 509 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

... in which the IFN-b gene contained or not the ARE (pIFNHA and pIFNHAAU–) In addition, the sequence encoding the HA epitope was inserted at the end of the IFN-b coding sequence to distinguish the ... containing the hairpin in the 5¢UTR (Fig 4B) Deadenylation of IFN-b mRNA occurs independently of viral infection Fig Deadenylation of IFN-b mRNA is...

Ngày tải lên: 17/03/2014, 10:20

8 361 0
Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx

Báo cáo khoa học: Functional interplay between viral and cellular SR proteins in control of post-transcriptional gene regulation pptx

... The interplay between viral and cellular SR proteins certainly has a substantial effect on post- Table Functional interplay between viral proteins and cellular SR proteins as well as SR kinases ... Therefore, SR proteins, together with other RNA-binding proteins, coordinate the coupling of splicing and polyadenylation Viral and cellular SR pr...

Ngày tải lên: 23/03/2014, 06:20

10 317 0
Báo cáo khoa học: Presence of membrane ecdysone receptor in the anterior silk gland of the silkworm Bombyx mori pdf

Báo cáo khoa học: Presence of membrane ecdysone receptor in the anterior silk gland of the silkworm Bombyx mori pdf

... protein concentration for the binding assay was determined using 25 nM [3H]PonA and increasing amounts of proteins in individual incubations The percentage of specific binding increased in a protein ... that of 20-hydroxyecdysone A second line of evidence to support the existence of a membrane receptor is that the binding affinity of PonA is less than that of 20E...

Ngày tải lên: 30/03/2014, 15:20

9 316 0
Báo cáo khoa học: "Diprosopus, craniorachischisis, arthrogryposis, and other associated anomalies in a stillborn lamb" ppt

Báo cáo khoa học: "Diprosopus, craniorachischisis, arthrogryposis, and other associated anomalies in a stillborn lamb" ppt

... were absent A hypoplastic medulla oblongata was present, and the cerebella were absent in both heads Arthrogryposis flexio was observed in both articulationes metacarpophalangeae and the right articulationes ... [4,9,19] We also observed cleft palate in the right head of this diprosopic Diprosopus, craniorachischisis, arthrogryposis, and other associated anomalies in...

Ngày tải lên: 07/08/2014, 23:22

3 291 0
w