a c and associated proteins in neurological disease
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
Ngày tải lên :
19/02/2014, 05:20
... 1–68 Academic Press Inc., San Diego 28 Takahara PM, Rosenzweig AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin ... drug cisplatin Nature 377, 649–652 29 Zlatanova J, Yaneva J & Leuba SH (1998) Proteins that specifically recognize cisplatin-damaged DNA: a clue to anticancer activity of cisplatin FASEB J 12, ... arrest via p21WAF1 ⁄ CIP1 induction and activation of DNA repair processes that, in general, confer chemoresistance to cancer cells The other pathway leads to programmed cell death through activation...
- 14
- 597
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig Nucleotide and deduced amino ... 221 CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
- 12
- 772
- 0
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx
Ngày tải lên :
19/02/2014, 18:20
... counter cataract development are certain to emerge 2614 Y Sun and T H MacRae Cataract and a- crystallin posttranslational changes Posttranslational modifications of aA- and aB-crystallin, including ... linking cataract and a- crystallin post-translational changes is compelling, but there are examples of extensive a- crystallin modification before disease appears, and cataract associated protein ... deregulated intracellular signaling proteins and transcription factors 2619 Small heat shock proteins and disease Y Sun and T H MacRae Table sHSP modifications associated with disease Many diseases are...
- 15
- 573
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18) against E coli ATCC 25922 was evaluated by a liquid microdilution assay ... þ B=MICB Þ=n where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is ... FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains Antimicrob Agents...
- 18
- 494
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
Ngày tải lên :
23/03/2014, 03:20
... Peroxiredoxin Apolipoprotein A- I Abhydrolase domain containing 14b D-Amino Protein name ApoA4 ActB Nsfl 1C Acy1 Pgam1 Inmt Prdx6 ApoA1 Abhd14b DnaJA1 Pdzk1 Hao3 Erp29 Aco1 Me1 Eno1 Dao1 Hao3 Mpst Acads ... bisphosphatase and catalase, whereas liver enolase and carbonic anhydrase were downregulated Comparable amounts of b-actin were present in AgxtKO and wild-type cytosolic fractions, and the absence ... Aco1, aconitase 1; Agt), alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydrase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; Eno1, enolase 1, a...
- 9
- 481
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
Ngày tải lên :
23/03/2014, 13:20
... bovine heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) ... mice expressing human HIP/ PAP in the liver, HIP/PAP enhances liver regeneration and acts as a hepatic cytokine that combines mitogenic and anti-apoptotic functions using pathways involving PKA ... proliferating ductules as well as by hepatocarcinoma and cholangiocarcinoma cells Am J Pathol 155, 1525–1533 Lasserre, C. , Colnot, C. , Brechot, C & Poirier, F (1999) HIP/PAP gene, encoding a C- type...
- 9
- 310
- 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
Ngày tải lên :
20/06/2014, 04:20
... relatively common disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence ... functional bracing did not violate the fracture site, allowing vascular regeneration and eliminating further damage to the peripheral and intramedullary blood supply which occurs during plate and screw ... 10.1186/1749-799X-5-33 Cite this article as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of...
- 4
- 402
- 0
A novel membrane pool of protein kinase c and its role in mammalian cell signaling
Ngày tải lên :
12/09/2015, 21:10
... may have separate and unique functions in the cell 1.3.3.1.2.4 Fatty acids In the absence of PS and Ca2+, cis-unsaturated fatty acids such as arachidonic, linoleic, linolenic and oleic acid can ... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... subcellular targeting of PKC is also mediated through association with other signaling proteins3 44 For example, AKAP79 colocalizes PKC with PKA and calcineurin; gravin binds PKC and PKA; and InaD clusters...
- 221
- 308
- 0
Sterol rich membrane domains and membrane associated proteins in the fission yeast schizosaccharomyces pombe
Ngày tải lên :
15/09/2015, 17:09
... 18 C and cells overexpressing mad2+ under the nmt1-promotor, (D) cdc7-24 cells at 36 C Arrows indicate strong medial staining in (A) and faint medial staining in (C) and (D) Arrowheads indicate ... Balsubramanian et al (1998) detected actin rings in mitotic cdc15 -A5 cells as well as in dividing cdc15-140 cells obtained from synchronous cultures using rhodaminconjugated phalloidin and α-Cdc4p antibodies ... (Demeter and Sazer, 1998) Mammalian homologues of Cdc15p, such as proline, serine, threonine phosphatase interacting proteins (PSTPIP) and Toca-1, colocalise with the cortical actin cytoskeleton including...
- 186
- 262
- 0
Nutritional Status and Associated Factors in Institutionalized Elderly docx
Ngày tải lên :
05/03/2014, 21:20
... (BMI), calf (CP), arm (AC), waist (WC) and Hip circumference (HC), Waist / hip ratio (WHR), Triceps skinfold (TSF) and adjusted arm muscle area (AMBc) All measurements were obtained in accordance ... of daily living and greater dependence on care, including meals and purchase of food [19] The results of the Health, Welfare and Aging in Latin America and the Caribbean Project, which evaluated ... such as rising from a chair or carrying objects [19] There was high prevalence of overweight and high risk of diseases associated with obesity and cardiovascular disease according to BMI, WC and...
- 5
- 552
- 0
Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc
Ngày tải lên :
07/03/2014, 21:20
... self-assembly, and a proline and arginine-rich domain (PRD) that mediates interactions with SH3 domains of effector proteins of the actin cytoskeleton Dynamins are required in phagocytosis and in ... profilin, Abp1, syndapin, intersectin and cortactin Recently, it has been shown that the yeast DRP, Vps1, is also required for normal actin organization and that it interacts with the actin regulatory ... Marians RC & Small GM (1997) A complex containing two transcription factors regulates peroxisome proliferation and the coordinate induction of beta-oxidation enzymes in Saccharomyces cerevisiae...
- 13
- 372
- 0
Behind the Scenes or, Thirty years a slave, and Four Years in the White House pptx
Ngày tải lên :
29/03/2014, 22:20
... world A breach of trust if breach it can be called of this kind is always excusable My own character, as well as the character of Mrs Lincoln, is at stake, since I have been intimately associated ... the rank of Captain and A D C he went to the field, and remained in the army till the close of the war I well recollect a little incident that gave me a clearer insight into Robert's character ... since I aided in bringing a solemn truth to the surface as a truth, perhaps I have no right to complain Here, as in all things pertaining to life, I can afford to be charitable It may be charged...
- 112
- 366
- 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
Ngày tải lên :
19/06/2014, 22:20
... Yoshinaga M, Ohkawara S, Nariuchi H, McCracken Jr, G.H.: Tumor necrosis factor alpha / cachectin and interleukin beta initiate meningeal inflammation J Exp Med 1990, 172:497-507 Saukkonen K, Sande ... Ethics Board Committee Control CSF was collected from patients undergoing diagnostic spinal tap (n = 10) and revealed no inflammatory CNS disease, based on normal CSF protein and glucose levels and ... Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and evidence of neuroprotective effects of IL-18-binding protein after experimental closed head injury J Cereb...
- 6
- 436
- 0
situation of hiv, hbv, hcv infection and associated factors in some high risk populations in hanoi, 2008-2010
Ngày tải lên :
25/07/2014, 14:07
... participated in chronic haemodialysis are at increased risk for HCV The prevalence of HCV in such patients reaches 15%, although it has declined in recent years A number of risk factors have been ... in Asia and Africa Approximately 10% of them has concurrent chronic HBV and 4-5 million has chronic HCV With the increased availability of antiretroviral therapy, the number of people surviving ... important infectious diseases worldwide The majority of cases occuring in regions of Asia (predominant in East and Southest Asia) and Africa It is estimated that 10 to 15 million people in Vietnam...
- 14
- 298
- 0
Báo cáo y học: "Oesophageal Perforation: A diagnostic and therapeutic challenge in a resource limited setting. A report of three cases." ppsx
Ngày tải lên :
10/08/2014, 09:22
... smelling sputum, dysphagia, and odynophagia since the incident which was 15 days ago There was an associated swinging fever, malaise and anorexia On examination, he was wasted very ill looking and ... faced by many medical practitioners in Sub Saharan Africa is the lack of proper therapeutic equipment which causes more harm unintentionally in these areas, as seen in our 2nd case All the above ... and Contrast imaging and experienced thoracic surgeon available In the cases we managed none of the patients met the selection criteria stated above and yet two achieved oesophageal healing This...
- 5
- 381
- 0
Báo cáo y học: "A novel and safe technique in closed tube thoracostomy" pdf
Ngày tải lên :
10/08/2014, 10:20
... Also pulmonary, cardiac, esophageal and main vascular injuries may occur by trochar that has a sharp point en route pleural space In the other hand failing the trochar assistance; it could not be ... other hand, angulation of the drain in surgical technique is not a rare occasion In such cases, poor drainage may be associated with the angulation point and the degree of angulation of the drain ... pleural space, it is termed as TM This complication occurs in locations: intraparenchymal, fissural, extrathoracic locations, and angulation of the drain in the pleural space Although TM usually...
- 4
- 428
- 0
báo cáo khoa học: " The membrane-spanning 4-domains, subfamily A (MS4A) gene cluster contains a common variant associated with Alzheimer’s disease" potx
Ngày tải lên :
11/08/2014, 12:21
... were selected to have a call rate above 95% (in each case, control, and combined group, within each dataset), and a minor allele frequency above 1% (again in each case, control, and combined group, ... Corporación Tecnológica de Andaluc a and Agencia IDEA (Consejer a de Innovación, Junta de Andaluc a) The Diabetes Research Laboratory, Biomedical Research Foundation University Hospital Clínico San Carlos ... probable AD in accordance with the criteria of the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer’s Disease and Related Disorders Association (NINCDS-ADRDA)...
- 8
- 391
- 0
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
Ngày tải lên :
11/08/2014, 17:21
... symptomatic [15] When leakage does occur, silicone can cause fibrosis and foreign body granulomatous reactions, especially when combined with certain fatty acids, resulting in pain and contractures ... inert substance, it has been associated in the literature with numerous, albeit rare, complications including local and systemic granulomatous inflammatory reactions affecting breast tissue, ... various connective tissue and autoimmune diseases and human adjuvant disease [4, 8, 9] At present, the mechanism of such complications is uncertain and in some cases, proof of such a relationship...
- 5
- 264
- 0
Báo cáo y học: " Breast conserving surgery with preservation of the nipple-areola complex as a feasible and safe approach in male breast cancer: a case report" pptx
Ngày tải lên :
11/08/2014, 23:21
... FBC: female breast cancer; FNA: fine needle aspiration; IDC: invasive ductal carcinoma; MBC: male breast cancer; SNB: sentinel node biopsy; US: ultrasound Competing interests The authors declare ... and a mammogram demonstrated a cm suspicious lesion, which was found to be cancer on both fine needle aspiration (FNA) and core biopsy The tumour was a grade invasive ductal carcinoma (IDC) Investigations ... Page of (page number not for citation purposes) Journal of Medical Case Reports 2008, 2:126 Abbreviations ANC: axillary node clearance; BCS: breast conserving surgery; DCIS: ductal carcinoma in...
- 3
- 275
- 0
Báo cáo y học: " Role of ADAM and ADAMTS metalloproteinases in airway diseases" pot
Ngày tải lên :
12/08/2014, 14:20
... domains are characteristic of ADAMs and include a disintegrin domain mediating cellcell, cell-matrix interactions via the interaction with integrins; a cystein-rich domain implicated in cell adhesion; ... complex than that of MMPs Domains shared with MMPs are the prodomain maintaining the catalytic site inactive and the metalloproteinase domain containing the Zinc binding site ADAM activation mechanisms ... Jameekornrak A, Limwongse C, Sangasapaviliya A, Jirapongsananuruk O, Assawamakin A, Chaiyaratana N, Luangwedchakarn V, Thongnoppakhun W: Association between ADAM33 polymorphisms and asthma in a Thai...
- 12
- 319
- 0