The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... pathogenesis of tissue damage incurred by the host in the course of severe sepsis and septic shock 2.3 Evidence for the involvement of NO in...
Ngày tải lên: 14/09/2015, 14:16
The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 2
... performance The selective iNOS inhibitor, AG, may be of interest as a therapeutic agent following prolonged hemorrhagic shock 44 CHAPTER Prolonged hemorrhagic shock model: The role of NO and PGE2 and the ... NO and COX -2 in Prolong hemorrhagic shock 1.6 The role nitric oxide and angiotensin II play in prolonged hemorrhagic shock The re...
Ngày tải lên: 16/09/2015, 15:54
The role of nitric oxide and prostaglandin e2 in prolonged hemorrhagic shock 1
... percussion injury Keywords: prolonged hemorrhagic shock; fluid percussion injury; nitric oxide; prostaglandin E2; aminoguanidine ix SUMMARY OF THESIS In our study of prolonged hemorrhagic shock, the ... following fluid percussion injury and hemorrhagic shock xv Aims of this thesis is to investigate Pathophysiology of prolonged hemorrhagic shock Role...
Ngày tải lên: 16/09/2015, 15:54
Báo cáo y học: "The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis" pps
... overproduction of cytokines and growth factors from the inflamed synovium may play a role in the pathophysiology of OA The low-grade OA synovitis is itself cytokinedriven, although the levels of proinflammatory ... in synovial inflammation and in activation of chondrocytes These cytokines can stimulate their own production and induce synovial cells and chondroc...
Ngày tải lên: 09/08/2014, 08:23
RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE
... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables for estimation of 2-AP low concentration like aromatic rice The ... from Rice 3.4 Investigating the changes of 2-AP and other volatile compounds of rice in Bun processing Table The volatile co...
Ngày tải lên: 28/08/2013, 16:28
Credit Growth and the Effectiveness of Reserve Requirements and Other Macroprudential Instruments in Latin America pdf
... borrowing.2 A summary of the recent use of macroprudential measures in Latin America is reported in Table Despite their increasing use, the effectiveness of macroprudential policies in leaning against ... measure the changes in RRs and in other macroprudential policies Our findings indicate that RRs and other macroprudential policies lead to a moder...
Ngày tải lên: 06/03/2014, 04:21
BÁO CÁO "RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE" doc
... from Rice 3.4 Investigating the changes of 2-AP and other volatile compounds of rice in Bun processing Table The volatile compounds in non-soaking and 12 hours soaking of Khao Dawk mali recorded ... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables fo...
Ngày tải lên: 19/03/2014, 16:20
Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx
... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization...
Ngày tải lên: 07/08/2014, 23:22
The role of CDC42, 1RSP53 and its binding partners in filopodia formation
... actin binding proteins (ABPs) which includes the sequestering proteins and the capping proteins Sequestering proteins inhibit polymerization by binding to monomeric G-actin, sequestering them ... modification of the actin network The ABPs have the following activities; Profilin and ADF cofilin bind G- and F-actin and they are mostly concentrated at the leading edge...
Ngày tải lên: 14/09/2015, 14:14
Báo cáo y học: " Central role of nitric oxide in the pathogenesis of rheumatoid arthritis and systemic lupus erythematosus" potx
... abnormalities in systemic lupus erythematosus Curr Immunol Rev 2005, 1:61-67 Perl A: Emerging new pathways of pathogenesis and targets for treatment in systemic lupus erythematosus and Sjogren’s syndrome ... regulates mammalian target of rapamycin activity and TCRζ expression in SLE The mammalian target of rapamycin (mTOR) is a serine/ threonine protein kinase a...
Ngày tải lên: 12/08/2014, 14:22
Role of nitric oxide in wound healing facilitatory effects of nitrosoglutathione a nitric oxide donor on the extracellular matrix deposition characteristics of wound healing
... important parameters They are a) rate of wound healing, b) collagen content of the scar and c) Biomechanical strength 1.2.1 Rate of wound contraction Clinically, evaluation of wound healing is done ... leading to rapid wound closure Preparation of the wound bed, choice of growth factor appropriate to the stage of healing, and quantity and duration of admin...
Ngày tải lên: 17/09/2015, 17:19
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...
Ngày tải lên: 20/02/2014, 01:20