The role of CDC42, 1RSP53 and its binding partners in filopodia formation
... actin binding proteins (ABPs) which includes the sequestering proteins and the capping proteins Sequestering proteins inhibit polymerization by binding to monomeric G-actin, sequestering them ... modification of the actin network The ABPs have the following activities; Profilin and ADF cofilin bind G- and F-actin and they are mostly concentrated at the leading edge...
Ngày tải lên: 14/09/2015, 14:14
... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization...
Ngày tải lên: 07/08/2014, 23:22
... overproduction of cytokines and growth factors from the inflamed synovium may play a role in the pathophysiology of OA The low-grade OA synovitis is itself cytokinedriven, although the levels of proinflammatory ... in synovial inflammation and in activation of chondrocytes These cytokines can stimulate their own production and induce synovial cells and chondroc...
Ngày tải lên: 09/08/2014, 08:23
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... pathogenesis of tissue damage incurred by the host in the course of severe sepsis and septic shock 2.3 Evidence for the involvement of NO in...
Ngày tải lên: 14/09/2015, 14:16
The cult of guangze zunwang and its religious network in the chinese diaspora, 19th century 2009
... prompted the establishment of Guangze Zunwang temples in the two host countries This study examines the cult of Guangze Zunwang and its religious network connecting Southeast China and the Chinese ... examines the cult of Guangze Zunwang and its religious network connecting Southeast China and the Chinese communities in Singapore...
Ngày tải lên: 16/10/2015, 15:38
Characterisation of the role of bifocal and its interacting partners in drosophila development
... interacting partners and their role in the developing cytoskeleton The work in this thesis focuses on the developing fly eye, the targeting of axons from the eye to the brain and the anchoring of posterior ... and embryonic development The work described in this thesis uses Drosophila as the model organism and deals with the characterisation...
Ngày tải lên: 12/09/2015, 09:42
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A,...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic network...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo "The role of color luminescence centers Mn, Cu, Co in the semicondutors with wide band gap ZnS, ZnO and their applications " pptx
... by Cu2+, Mn2+, Co2 + ions [7-11] In this paper, we study the role of color luminescence centers Cu, Mn, Co in the semiconductors with wide band gap of ZnS, ZnO and test application of ZnS:Cu material ... band is greater than that of the blue band As increasing the concentration of Cu, the intensity of the blue band decreases whi...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...
Ngày tải lên: 23/03/2014, 15:21
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in...
Ngày tải lên: 30/03/2014, 11:20