Structural and functional studies on type III and type VI secretion system proteins

... I Secretion System 1.6 Type II Secretion System 10 1.7 Type III Secretion System 12 1.8 Type IV Secretion System 26 1.9 Type V Secretion System 27 1.10 Type VI Secretion System 29 1.11 Aim of ... Island Figure: Type I–V secretion systems in Gram-negative bacteria Figure: 1.3 Model of pilus-mediated secretion via the type II secretion system 11...

Ngày tải lên: 14/09/2015, 14:13

Ngày tải lên: 10/09/2015, 15:48

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

... such as Escherichia coli, Salmonella, Shigella, and Yersinia species E tarda is a relatively new genus, and the first report about the genus of Edwardsiella was in Japan by Sakazaki and Murata (1962) ... bromo-4-chloro-3-indolyl-β-D-galactopyranoside xv SUMMARY Edwardsiella tarda is an opportunistic gram-negative bacterial pathogen affecting both animals and humans The abi...

Ngày tải lên: 15/09/2015, 17:11

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion,...

Ngày tải lên: 12/09/2015, 08:18

... DNA-editing enzyme) in host target cells, which resulted in the accumulation of mutations in the tumour suppressor protein TP53 Type IV secretion in H pylori pathogenesis [22] Thus, the induction of ... to in uence the pathogenesis of H pylori There are two classical secreted virulence factors present in H pylori: the vacuolating cytotoxin (VacA) and...

Ngày tải lên: 14/02/2014, 19:20

... tip of the pilus Cag proteins in the T4SS apparatus is not clear, although several of them are essential for the secretion of CagA or the induction of interleukin-8 [23] The NTPases battery of the ... proteins Other components are essential for the formation of the T4SS complex: VirB1 allows for the insertion of the system in the periplasm and VirB3, t...

Ngày tải lên: 06/03/2014, 00:21

... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...

Ngày tải lên: 18/02/2014, 12:20

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [H...

Ngày tải lên: 15/02/2014, 01:20

... 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and vertebrate TnI and revealed for the first time that (a) the alternative ... of the troponin complex In molluskan muscles, the C-terminal region does not function and troponin regulates contraction only through the act...

Ngày tải lên: 20/02/2014, 01:20

... loop, the first and last turns of helices E and F, and the C-terminus helices I and J In addition, there is a lysine-rich N- and C-terminus, in accordance with the basic isoelectric point of CagS ... as that of other members of this family Finally, when crystallized in the presence of Cu(II), the protein shows the presence of the ion coordinated in a...

Ngày tải lên: 06/03/2014, 00:21

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

... In immunotype 1, the outer core has at least one O-acetylation site and the O-acetyl group is present in the core of a minority of the LPS molecules The position of the O-acetyl groups in the core ... all of the data together, the structures of the core and core with one O-polysaccharide repeating unit in the LPS of P aeruginosa immu...

Ngày tải lên: 24/03/2014, 03:21