Functional lipidomics analysis of retrovirus envelopes

... 2005) 27 Chapter – Lipidomics analysis of retrovirus envelopes 2.1 Introduction In this study, we anticipate that a detailed analysis of the lipid composition of retrovirus envelopes compared ... lipid analysis 62 2.3.7 Neutral lipid composition of retroviruses envelopes 65 CHAPTER – FUNCTIONAL ROLES OF LIPIDS IN RETROVIRUS ENVELOPES 68 3.1 INTRODUCTION 68 3...

Ngày tải lên: 14/09/2015, 14:08

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

... revolutionized the functional analysis of genes identified by genomic sequencing [1-3] Several factors make RNAi in Drosophila cell cultures an excellent approach for such functional genomic analysis of animal ... motile cells Few metazoan cell systems, however, permit the use of genetic analysis to identify the complement of genes contributing to the generation of...

Ngày tải lên: 06/08/2014, 18:20

... functional similarity of 29 viral miRNAs as illustrated in Figure The functional similarity matrix of the pairwise viral miRNAs was then analyzed by R package pvclust to assess the uncertainty of clustering ... as: Yu and He: Functional similarity analysis of human virus-encoded miRNAs Journal of Clinical Bioinformatics 2011 1:15 Submit your next manuscript to BioMed Centr...

Ngày tải lên: 10/08/2014, 09:22

... activation of the ‘profemale’ Wnt signaling pathway In order to understand the role of the brain in the sex VIII change process, a microarray analysis was also carried out on the brain of adult ... on the gonadal maturation stage Long-term treatment of GnRH could also promote the development of spermiating testis in juvenile seabass To test the hypothesis...

Ngày tải lên: 09/09/2015, 11:21

... activity of DEC1 is also required for the interaction with BMAL1 Binding of DEC1 mutants to a CACGTG E-box To examine the binding ability of DEC1 mutants to the CACGTG E-box in the Dec1 promoter, ... for DEC1 suppressive activity against CLOCK/BMAL1-induced transcription In addition, the N-terminal region of DEC1, including the bHLH domain, interacted with...

Ngày tải lên: 19/02/2014, 16:20

... chemically deglycosylated with anhydrous trifluoromethanesulfonic acid (TFMS) using the GlycoFree kit k-500 from Oxford GlycoSystems, USA and submitted to SDS/PAGE Human a-1 acid glycoprotein was ... stained with Coomassie Blue R-250 Myotoxins and DM64 were used as controls Statistical analysis Results represent mean ± SEM (n ‡ 4) Data were statistically evaluated by Analysis of Va...

Ngày tải lên: 21/02/2014, 01:21

... not been functionally proved and the lability of substrate and product rule out any cocrystallization The setting of a helices and b-strands causes very similar CD spectra for this class of enzymes ... mutagenesis MATERIALS AND METHODS Expression vector The FLS cDNA from satsuma mandarin fruits, C unshiu [30], was excised with EcoRI and XhoI from the Bluescript vector...

Ngày tải lên: 21/02/2014, 03:20

... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...

Ngày tải lên: 22/02/2014, 04:20

... the C-terminal domain, the E coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expression of the maximum catalytic activity, and in allosteric regulation ... Results Expression and purification of E coli Pta and truncated Ptas containing the C-terminal end By analysis of the protein domain architecture of E coli Pta...

Ngày tải lên: 06/03/2014, 11:20

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

... transfected individually or in combination into ldlD cells and immunoprecipitation was carried out with myc antibody using detergent-soluble cell lysates containing the amount of protein indicated ... 4¢-epimerase mutations associated with the intermediate form of type III galactosaemia J Inherit Metab Dis 31, 108–116 Timson DJ (2005) Functional analysis of disease-cau...

Ngày tải lên: 07/03/2014, 00:20

... to the cytosol Here we confirm and extend earlier studies of these AAA-peroxins and give a further detailed functional analysis of their cassette structure and interaction The interaction of Pex1p ... for the Pex1p Pex6p interaction and their functional role in peroxisome biogenesis Results The contribution of Pex1p and Pex6p to peroxisomal bioge...

Ngày tải lên: 07/03/2014, 16:20

... L decemlineata (b) the analysis of mRNA expression profile of L decemlineata, EcR and USP, and (c) the measurement of the binding affinity of steroidal and nonsteroidal ecdysone agonists to the ... hormone receptors of L decemlineata agonists for the molecular interaction with the molting hormone receptor Here, we report (a) the determination of pr...

Ngày tải lên: 07/03/2014, 21:20

... group of GHMP kinases in which proton transfer does not play a major role in the rate determining step of catalysis That five of the 10 disease-causing mutations resulted in insoluble protein in ... play a major role in the rate-determining step of catalysis Several of the disease-causing mutations are not soluble following induction in E coli Although all the mut...

Ngày tải lên: 08/03/2014, 02:20