... The Comparative Study of Insults in Vietnamese and American English aimed at providing Vietnamese users of English and American users of Vietnamese with some knowledge about social factors influencing ... being female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group...
Ngày tải lên: 26/11/2013, 13:16
... percentages of direct/indirect criticism between American and Vietnamese online newspapers through the layout and illustrations of articles as well as the language used 4.2 4.2.1 Data analysis and ... 4, a comparison of criticism in American and Vietnamese e -newspapers has been conducted Following is the summary of major similarities and differences in...
Ngày tải lên: 07/11/2012, 14:44
Báo cáo khoa học: "A comparative study of Sephadex, glass wool and Percoll separation techniques on sperm quality and IVF results for cryopreserved bovine semen" pptx
... SE (n = 28) Sperm separation techniques on IVF in cryopreserved bovine semen 253 Table Effect of glass wool filtration and Percoll separation of spermatozoa on IVF results Cleavage Spermatozoa ... = 6) Table Effect of control, Sephadex and glass wool filtration of spermatozoa on in-vitro fertilization (IVF) results Cleavage Spermatozoa treatment...
Ngày tải lên: 07/08/2014, 23:22
Getting migrant labour policies right for citizens a comparative study of france, canada, singapore and dubai
... France and Canada and Singapore and Dubai are more appropriately compared in pairs because of their similar migrant labour and political realities However, it would add value if a finding in one case ... BIBLIOGRAPHY 95 iii SUMMARY Getting Migrant Labour Policies Right for Citizens: A Comparative Study of France, Canada, Singapore and Dubai A...
Ngày tải lên: 02/10/2015, 17:15
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... To compare the amount of lexical cohesive items in English newspaper articles and Vietnamese ones - To suggest some practical applications of Lexical Cohesion in teaching and in learning English ... adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs in newspaper articles have ne...
Ngày tải lên: 14/12/2013, 00:40
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... from the liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... clarify the involvement of the PtdIns cycle in the accumulation of arachidonic acid in PtdIns of fish Fig Effects of docosahexaenoic acid (D...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in sus...
Ngày tải lên: 23/03/2014, 07:20
báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx
... implications of nonlinear variability indexes that have been utilized to characterize MFC signals of the elderly subjects during walking Poincaré plot geometry and ApEn analysis of MFC gait data of elderly ... complex and nonlinear [5-7], the application of nonlinear technique seems appropriate In this study, we, therefore, investigate the two types of n...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc
... regard to HIV/ AIDS; • To determine the knowledge, attitudes, and risk behaviors of diabetic patients in regard to HIV/AIDS; and • To compare these groups on these parameters and make conclusions as ... and risk behaviors of schizophrenic patients with those of diabetic patients Specific objectives: • To determine the knowledge, at...
Ngày tải lên: 20/06/2014, 08:20