a comparative study of the usa and four latin american countries

... (1998) evaluated the ability of MTA and amalgam to seal furcal perforations in extracted human molars using an anaerobic bacterial leakage model Fusobacterium nucleatum was used in this study and ... when the antibacterial effects of MTA was compared to amalgam, super-EBA and ZOE, it was found that MTA had some 12 Literature Review antibacterial effect against some of the facultative anaerobes ... ISO Standards (Wataha JC 1996) 2.3.2 Clinical applications of MTA Torabinejad and Chivian (1999), described the various uses of MTA in vital pulp therapy, repair of root perforations, and as a root-end...

Ngày tải lên: 15/09/2015, 22:51

... were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards ... culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria Statistical analysis ... 36 KAVITA MODI – PAREKH ET AL respiratory diseases other than tuberculosis (Table 1A serial-c) These cases were as follows, two each of asthma, pneumonia and cancer lung, one each of post CABG,...

Ngày tải lên: 06/03/2014, 04:20

... during the third term Apart from sex and age, we also evaluated (as background variables) the participants' experiences of health care as a patient and as a relative, which were ranked as mainly ... conduct a CT scan and to secure respiratory function, it is necessary to intubate and mechanically ventilate the patient The CT scan shows a large haemorrhage in the left central part of the brain A ... neurosurgeon' and 'the [lack of] quality of life'; the general public gave priority to the first argument, whereas the physicians stressed the latter Neither group was swayed by the age of the patient and...

Ngày tải lên: 13/08/2014, 10:20

... both Reena and Lisa are spatially located on the margins of the celebrations that are taking place the song and dance and feasting after the wedding The space of the heterosexual wedding and its ... casually as Mumbai Noir in Hindi cinema, realism and adaptations of classic literary works such William Shakespeare’s Macbeth and Othello (Vishal Bharadwaj’s Maqbool and Omkara respectively) and Vladimir ... competition and the Taj Mahal figurine magically lights up to signify Nina and Lisa’s triumphant love The song from the movie Mughal-E-Azam, ‘Jab Pyaar Kiya To Darna Kya’, literally translated as ‘What...

Ngày tải lên: 16/10/2015, 12:00

Ngày tải lên: 07/11/2012, 14:17

... Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics 10 3.3 A study of the discourse structure and some ... 14 a, Use of Grammar 14 a1 Modality 14 a2 Use of Active / Passive voices 14 a3 Sentence order 15 a4 Length of sentences 15 a5 Kinds of sentences 16 b Use of vocabulary 17 b1 Archaic words and ... COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4.2 20 Purposes and typical legal characteristics of the International Convention on Human...

Ngày tải lên: 07/11/2012, 14:17

... of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical form is the quality or state in ... therefore, the General Assembly proclaims this universal declaration of human rights as a common standard of achievement for all peoples and all nations(last phrase of the Preamble) + The purposes, basis ... expanding field, providing insights into the problems and processes of language use and language learning, and is therefore of great importance to language teachers Traditionally, language teaching...

Ngày tải lên: 07/11/2012, 14:17

... secondary education, including general and vocational education, make them available and accessible to every child, and take appropriate measures such as the introduction of free education and offering ... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance ... use of children in pornographic performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale...

Ngày tải lên: 07/11/2012, 14:17

... human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the ... on Empirical Methods in Natural Language Processing and 947 Computational Natural Language Learning (EMNLP-CoNLL’2007), pp 277 – 286, Prague, Czech Republic, June S Jayaraman and A Lavie 2005 ... Zhang, A Aw and H Li 2008 Regenerating Hypotheses for Statistical Machine Translation In: Proceeding of COLING 2008 pp105-112 Manchester, UK Aug D Chiang 2007 Hierarchical phrase-based translation...

Ngày tải lên: 17/03/2014, 01:20

... Cys64Ala F-TDPX1 Cys83Ala R-TDPX1 Cys83Ala TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC ... ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTG GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTC GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAG ... mutagenesis of Cys35, Cys64 and Cys83 to Ala were performed to extend the ndings of the MS analysis The Cys35Ala and Cys83Ala mutants were expressed and puried as before However, the Cys64Ala...

Ngày tải lên: 23/03/2014, 07:20

... deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis system (Agilent Technologies, ... Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and downregulated genes (compared with all 12 441 annotated genes) was calculated using the ... up-regulateda in ATMSC-Hepa and human liver for each liver-related signal pathway Signal pathway Blood clotting cascade Complement activation, classical pathway Eicosanoid synthesis Fatty acid omega oxidation...

Ngày tải lên: 30/03/2014, 04:20

... with their careers and the career opportunities available to them is a further measure of demoralization of nurses and offers some substantiation of the disaffection associated with working in the ... important to understand what motivates them and the extent to which the organization and other contextual variables satisfy them Job dissatisfaction has frequently been cited as the primary reason ... Suliman WA, Abu Gharieb P: Jordanian nurse: Job dissatisfaction and anticipated withdrawal from practice Dirasat, medical and biological 1996, 23(2):78-87 Lee FK: Job satisfaction and autonomy of...

Ngày tải lên: 18/06/2014, 17:20

... situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of protein ... demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA can be safely transferred to and expressed within human ... cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Materials and method Materials Ham’s F12 medium,...

Ngày tải lên: 09/08/2014, 01:23

... health systems in Southeast Asia, drawing on the cases of Thailand, Singapore and Malaysia, via an extensive review of the academic and grey literature, as well as insights from health consultancies ... regional conferences enabled the researchers to pinpoint Singapore, Thailand and Malaysia as the three main hubs for medical tourism in Southeast Asia for comparative analysis Broadly, there are four ... Southeast Asia, especially in Thailand, Singapore and Malaysia, the main regional hubs for medical tourism, where medical tourist visas are available and government agencies have been established...

Ngày tải lên: 11/08/2014, 14:21

... than or equal to 40 kg/m2 Statistical analysis Parametric interval data were analyzed using a two-tailed Student's t test These data are reported as mean ± standard deviation Nonparametric data ... not adequately assess the rate of tracheal stenosis or tracheomalacia in these patients Third, the complication rates are derived from a single tertiary care center and may not be applicable ... WJ conducted the literature search, collected the data, and performed the statistical analysis Both authors read and approved the final manuscript Page of (page number not for citation purposes)...

Ngày tải lên: 13/08/2014, 03:20

... 13 that a comparative analysis can offer us more insight into broader social changes that have taken place in the Singapore case and allow for a more nuanced and sensitive reading of Chinatown‘s ... centres and coffee shops located island-wide Fishball noodles, kway chap18, handmade noodles, bak kut teh, prawn noodles, steamboat and the like are all easily available and at much lower prices all ... clustering of similar functions and dominance of a particular cuisine in Yaowarat, the concentration of particular foods and the complementarity of the products hence stand as marked contrasts to the...

Ngày tải lên: 05/10/2015, 18:58

Ngày tải lên: 24/03/2016, 09:37

... from the liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... yellowtail Lipids from yellowtail have a preponderance of docosahexaenoic acid over arachidonic acid In fact, docosahexaenoic acid and arachidonic acid made up 28.4% and 3.5%, respectively, of the ... was used as an acyl acceptor, the acyltransferase activity of the fish liver microsomes acylated docosahexaenoic acid more effectively than arachidonic acid (Fig 2B) At a fatty acid concentration...

Ngày tải lên: 08/03/2014, 08:20

Ngày tải lên: 16/03/2014, 03:20