... gender, age, time from diagnosis and anxiety Descriptive statistics are given as mean ± standard deviation (SD) Results The mean age of the sample was 54.08 ± 16.60 years and mean time from diagnosis ... everyday needs This inadequacy may lead to heightened anxiety and depression, which in turn may worsen the everyday inadequacy It has been reported that this is (probably) a factor that leads BA and ... disease conditions and it is known that adaptation is a crucial survival factor in chronic diseases [22] Conclusion Patients suffering from BA and COPD have a significantly higher rate of anxiety...
Ngày tải lên: 08/08/2014, 23:20
... 25 v Abstract This paper carries out a systematic and comprehensive study on the selection of themes and vocabularies in Singapore and Malaysia’s Chinese teaching materials Through the comparison ... with targets and needs of local education With regard to quality of words, this paper analyses the selection of words in Singapore and Malaysia’s teaching materials with the HSK vocabulary list ... themes and vocabularies in Singapore and Malaysia’s teaching materials, this paper attempts to exemplify the influence of local Chinese education’s orientation on teaching materials compilation...
Ngày tải lên: 16/10/2015, 11:57
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
... 14 a, Use of Grammar 14 a1 Modality 14 a2 Use of Active / Passive voices 14 a3 Sentence order 15 a4 Length of sentences 15 a5 Kinds of sentences 16 b Use of vocabulary 17 b1 Archaic words and ... Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics 10 3.3 A study of the discourse structure and some ... Convention and its realization 23 4.3.2.2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/ Passive voices 27 a3 Sentence order 27 a4 Length of sentences 27 a5 Kinds of sentences...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
... language learning, and is therefore of great importance to language teachers Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain ... Modality A modal form is a provision of syntax that indicates the predication of an action, attitude, condition, or state other than that of a simple declaration of fact The modality of a grammatical ... shall be prohibited in all their forms (Article of Universal Declaration of Human Rights) b Use of vocabulary b1 Archaic words and phrases Few archaic words and phrases are found in Declarations...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
... spiritual and moral well-being and physical and mental health To this end, States Parties shall: (a) Encourage the mass media to disseminate information and material of social and cultural benefit ... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance ... performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic in children for any...
Ngày tải lên: 07/11/2012, 14:17
A comparative study of criticism between american and vietnamese online newspapers
... discrimination via the picture of their new president Barack Obama and the confirmation that “we’ve moved beyond race” Also, graphs and maps are used to clarify data presented in a critical story and ... display their emotions more openly than Americans and to view Americans as unemotional and cold Meanwhile, it is believed that Americans are much more direct than Asians, particularly Vietnamese As ... percentages of direct/indirect criticism between American and Vietnamese online newspapers through the layout and illustrations of articles as well as the language used 4.2 4.2.1 Data analysis and...
Ngày tải lên: 07/11/2012, 14:44
A comparative study of insults in vietnamese and american english
... female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as well as ... (P) of S and H iii) the absolute ranking (R) of impositions in the particular culture Social distance: intimates, acquaintances and strangers [13, p.1252] The relative power of hearer and speaker ... need treating with great care in both cultures can be found in situations 4, 5, and (the hearer was commented as naïve, as rabit and as having an opulent social life after having two dinners at her/his...
Ngày tải lên: 26/11/2013, 13:16
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... Qaeda network to replace the two men Al-Masri, a native of Egypt, was military leader of al Qaeda in Iraq Al-Baghdadi was leader of the Islamic State of Iraq, an umbrella group that includes al ... types of reiteration mentioned in later parts of the study Among content words, adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs ... newspaper articles have neutral nuances of meaning and they are used to modify factual information rather than to express reports attitude and opinions Some of the adjectives repeated are original...
Ngày tải lên: 14/12/2013, 00:40
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... were available 4-8 weeks later As no single gold standard was available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards ... culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria Statistical analysis ... respiratory diseases other than tuberculosis (Table 1A serial-c) These cases were as follows, two each of asthma, pneumonia and cancer lung, one each of post CABG, COPD and lung abscess and 12...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... yellowtail Lipids from yellowtail have a preponderance of docosahexaenoic acid over arachidonic acid In fact, docosahexaenoic acid and arachidonic acid made up 28.4% and 3.5%, respectively, of the ... 108, 89–106 Yamashita, A. , Sugiura, T & Waku, K (1997) Acyltransferases and transacylases involved in fatty acid remodeling of phospholipids and metabolism of bioactive lipids in mammalian cells...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage bilingual corpus for speech translation of travel conversations ... on Empirical Methods in Natural Language Processing and 947 Computational Natural Language Learning (EMNLP-CoNLL’2007), pp 277 – 286, Prague, Czech Republic, June S Jayaraman and A Lavie 2005 ... MT evaluation test set as our development set, and the NIST 2005 test set as our test set Table summarizes the statistics of the training, dev and test data for IWSLT and NIST tasks task data Sent...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTG GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTC GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACC AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAG CTCAGCCTTGAAACGCGTGGCGGCGAAACTTTTCACCT 5654 FEBS Journal ... Filtration Standard (Bio-Rad Laboratories, Hercules, CA) was used as calibration standards TryP1 and TryX were expressed and puried on a Ni-NTA matrix column in a similar manner as TDPX1 The...
Ngày tải lên: 23/03/2014, 07:20
party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007
... Partiya Ukrainy (Ob”ednana) (Social Democratic Party of Ukraine - United) Ukrains’ka Natsional’na Asambleya (Ukrainian National Assembly) Ukrains’ka Natsional’na Samooborona (Ukrainian SelfDefense Force) ... Latvijas Nacionglg Neatkarrbas Kustrba (Latvian National Independence Movement) Latvijas Sociglistiskg Partija (Latvian Socialist Party) Latvijas Tautas Fronte (Latvian Popular Front) Latvijas ... (U) UNA UNSO Communist Party of Ukraine Narodno-Demokratychna Partiya (Popular Democratic Party) Sotsialistychna Partiya Ukrainy (Socialist Party of Ukraine) Sotsial-Demokratychna Partiya Ukrainy...
Ngày tải lên: 04/06/2014, 00:49
báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc
... Knowledge of AIDS and HIV among various groups Br J Addict 1992, 87:1663-1668 Abstract Morio S, Soda K, Tajima K, et al.: Sexual behaviour of commercial sex workers and their clients in Cambodia Japan-Cambodia ... Nigerian women A study of antecedents and association Br J Psychiatry 1993, 163:645-650 Abstract Federal Ministry of Health: National HIV/AIDS and reproductive health survey Abuja, Nigeria 2003 SPSS: ... Chicago, Ill: SPSS Inc; 1998 Eriksson T, Sonesson A, Isacsson A: HIV/AIDS information and knowledge: a comparative study of Kenyan and Swedish teenagers Scand J Soc Med 1997, 25:111-118 Abstract...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: "Research Article A First Comparative Study of Oesophageal and Voice Prosthesis Speech Production" docx
... EURASIP Journal on Advances in Signal Processing Table 2: Average and standard deviation for patient data, vocal, and pressure parameters Personal data [Hz] [ms] [%] Tracheostoma pressure Acoustic ... Nazionale, et al., “Evaluation of various phonatory parameters in laryngectomized patients: comparison of esophageal and tracheo-esophageal prosthesis phonation,” Acta Otorhinolaryngologica Italica, ... better way to communicate and quality of the life Each patient’s voice signal (oesophageal EV and tracheoesophageal TEP) has been recorded and treated with the developed MATLAB program As an example,...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx
... Spiruridae, Setariidae, and Ascaridae One cestode family was recovered, Anoplocephalidae, and larvae of the fly Gasterophilus from the family Gasterophilidae The genera Habronema and Gasterophilus ... 32oE and 37oE and latitudes 0o10' and 0o17'N The area is dry and hot for most of the year Rainfal1 is unreliable and scarce; however the two main rainfal1 seasons are the long rains between March ... and random samples were taken to form aliquots of 5% for stomach and small intestinal samples and 10% from the combined large intestines Each aliquot was put into a sieve of 150 µm aperture and...
Ngày tải lên: 07/08/2014, 18:20