Molecular analyses of untranslated regions of hibiscus latent singapore virus

... mouth disease virus HAV Hepatitis A virus HCRSV Hibiscus chlorotic ringspot virus HCV Hepatitis C virus HLSV Hibiscus latent Singapore virus ORSV-S1 Odontoglossum ringspot virus, Singapore isolate ... 1.1 Introduction Hibiscus latent Singapore virus (HLSV) is a plant virus recently reported from Singapore (Srinivasan et al., 2002, 2005) The genome of the vi...

Ngày tải lên: 14/09/2015, 12:38

... List of abbreviations viii List of figures x List of tables xii Summary xiii CHAPTER X- RAY FIBER DIFFRACTION TECHNIQUES 1-19 1.1 INTRODUCTION 1.2 THEORY OF FIBER DIFFRACTION 1.2.1 Diffraction by ... Tobamovirus structure determination by fiber diffraction 16 1.6.3 Other filamentous virus structure by fiber diffraction 17 CHAPTER HIBISCUS LATENT...

Ngày tải lên: 10/09/2015, 15:53

... underlying mechanisms of gene silencing and related silencing responses Virus- encoded gene silencing suppressors offered an excellent tool for dissection of the gene silencing process Gene silencing suppressors ... 1.1 Gene silencing 1.1.1 Discovery of gene silencing 1.1.2 Induction of gene silencing 1.1.3 Mechanisms of gene silencing 1.1.4 Sys...

Ngày tải lên: 16/09/2015, 08:31

... understanding of mutations in flower morphology in this crop, an initial cloning of two MADS-box genes was realized in addition to preliminary expression analyses The genome size was determined in ... uncertain, whether stamen development is been initiated or whether the initiation of primordia is inhibited The determination of the flower organ identity and the und...

Ngày tải lên: 12/08/2014, 03:21

... characterization and analysis of isolation of Sin Nombre virus Journal of Virology 1995, 69:8132-8136 Huang C, Campbell WP, Means R, Ackman DM: Hantavirus S RNA sequence from a fatal case of HPS in New York ... test of7 neutrality (Fu and Li, 1993) for the M and S segments F test of neutrality (Fu and Li, 1993) for the M and S segments Only sequences from...

Ngày tải lên: 12/08/2014, 04:21

... characterization and analysis of isolation of Sin Nombre virus Journal of Virology 1995, 69:8132-8136 Huang C, Campbell WP, Means R, Ackman DM: Hantavirus S RNA sequence from a fatal case of HPS in New York ... test of7 neutrality (Fu and Li, 1993) for the M and S segments F test of neutrality (Fu and Li, 1993) for the M and S segments Only sequences from...

Ngày tải lên: 12/08/2014, 04:22

... help in the study of gonad differentiation in zebrafish Studying gene function utilizing widely used molecular tools, such as gene knock-out, morpholinos, and cell culture, is also difficult in zebrafish ... during gonad differentiation: foxl2, cyp19a1a, cyp11a, hsd3b and cyp17a1 in ovarian differentiation and star, nr5a1a and cyp11b2 in testicular differ...

Ngày tải lên: 14/09/2015, 14:06

... isolated DNA was extracted with phenol and chloroform, precipitated with ethanol and Na-acetate, and resuspended into water Total cellular DNA was also alternatively isolated with QIAamp DNA Blood ... Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusio...

Ngày tải lên: 16/03/2014, 05:20

... for retrieval of viral pathogens from infected leaf tissues and for the detection of viralderived transgene sequences in transgenic plants Results Use of FTA for sampling, retrieval and PCR-based ... Effective methods for sampling, storage and retrieval of viral pathogens from infected plant tissues allows not only identification of the viral pat...

Ngày tải lên: 19/06/2014, 08:20

... for retrieval of viral pathogens from infected leaf tissues and for the detection of viralderived transgene sequences in transgenic plants Results Use of FTA for sampling, retrieval and PCR-based ... Effective methods for sampling, storage and retrieval of viral pathogens from infected plant tissues allows not only identification of the viral pat...

Ngày tải lên: 20/06/2014, 04:20

... proteomics and variations of Bf venom, we studied individual venom of two specimens of Bf from Kolkata, India (designated as KBf) by a comparative proteomic and genomic approach The venom PLA and 3FTx ... structure of an inactive mutant of phospholipase A2 in the venom of Bungarus fasciatus (banded krait) J Biochem (Tokyo) 112, 707–713 Venom proteins of...

Ngày tải lên: 16/03/2014, 12:20

... heteromeric interactions of COPTs AIg5, a transmembrane protein with C terminal in the cytoplasm; NubI, N-terminal half of ubiquitin protein; NubG, mutated N-terminal half of ubiquitin protein; Cub, ... COPT3 and COPT7 in shoot, and slightly suppressed COPT2 and COPT4 in root Zn deficiency induced COPT1, COPT5, and COPT7 and slightly suppressed COPT4 in root and indu...

Ngày tải lên: 11/08/2014, 11:22

... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotI...

Ngày tải lên: 12/08/2014, 04:20

... diversity (Shannon's Figure intensity and distribution of positively selected sites in the C2, V3 and C3 regions along the course of HIV-2 infection Frequency, Frequency, intensity and distribution of ... evolution of the HIV-2 env gene In the present study we analyze, for the first time, the molecular evolution of the env C2V 3C3 regions...

Ngày tải lên: 13/08/2014, 05:21

... Srinivasan KG and Wong SM (2003) Cloning and Characterization of a new tobamovirus infecting Hibiscus rosa-sinensis) L Annual Meeting and Symposium of Korean Society for Plant Pathology Srinivasan ... purified HVS RNA Mechanical inoculation of purified HVS on test plants and ultra-thin section of HVS infected N benthamiana leaves SDS-PAGE and western blot analysis of HVS a...

Ngày tải lên: 17/09/2015, 17:19