Glial cell line drived neurotrophic factor (GDNF) family of ligands is a mitogenic agent in human glioblastoma and confers chemoresistance in a ligand specific fashion

... and Akt in both LN-229 and A1 72 human glioblastoma cell lines GDNF was however found to reduce the background activation of JNK and the A1 72 human glioblastoma cell line in a timedependent fashion ... potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mit...

Ngày tải lên: 14/09/2015, 12:13

... effects of GDNF 1. 5 GFR 1 9 10 11 1. 5 .1 GFR 1 and its spliced isoforms 11 1. 5.2 Expression and functional role of GFRα1a 12 ii 1. 6 Alternatively spliced isoforms 13 1. 7 Quantification of gene expression ... of The Two GFR 1 Spliced Receptor Isoforms 54 4 .1 Introduction 55 4.2 Materials and Methods 56 4.2 .1 Stably transfected cell lin...

Ngày tải lên: 05/10/2015, 22:31

... GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (1) (1) (1) (1) (1) (1) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (69) (72) ( 81) (69) (69) (69) Ol GFRa1 Dr GFRa1a Dr GFRa1b ... Rn GFRa1 Hs GFRa1 Mm GFRa1 (14 5) (14 8) (15 7) (14 9) (14 9) (14 9) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1 Hs GFRa1 Mm GFRa1 (225) (228) (237) (225) (225) (225) Ol GFRa1 Dr GFRa1a Dr GFRa1b Rn GFRa1...

Ngày tải lên: 03/10/2015, 20:57

... aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as compared to that of acute pain patients On the other hand, GABA ... microglia are involved in the early development of chronic pain, while astrocytes function in sustaining the pain (Vallejo et al., 2010) An interesting findin...

Ngày tải lên: 02/10/2015, 17:15

... al.: All-trans retinoic acid inhibits KIT activity and induces apoptosis in gastrointestinal stromal tumor GIST-T1 cell line by affecting on the expression of survivin and Bax protein Journal of ... down-regulated expression of survivin and up-regulated expression of Bax Materials and methods Cell lines and culture condit...

Ngày tải lên: 10/08/2014, 10:20

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

... distantly related to the AAA+ and AP/NACHT NTPases [10,11,13] All eukaryotic and several bacterial members of the KAP family contain two or four transmembrane segments inserted into the P-loop NTPase ... [10] The ASCE division includes AAA+, ABC, PilT, superfamily 1/2 (SF1/2) helicases, and RecA/F1/F0 classes of ATPases, and a large assemblage of NTPases...

Ngày tải lên: 09/08/2014, 20:20

... organs and tumoral tissues may provide a fertile substrate or are some way predisposed targets for secondary growth of renal cell carcinoma The diagnosis of renal cell carcinoma metastasizing to ... metastasis to follicular variant of papillary carcinoma of thyroid Arch Pathol Lab Med 1999, 123:703-706 Han HS, Kim EY, Han JY, Kim YB, Hwang TS, Chu YC: Metastati...

Ngày tải lên: 10/08/2014, 23:21

... Attenuation of LXF-289 cell proliferation by ATP is mediated by the activation of the MEK ⁄ ERK1 ⁄ 2, PI3K and p38 MAPK pathways Activation and translocation of the transcription factors NF -jB1 (p50) and ... Table Inhibition of proliferation of LXF-289 lung tumor cells Effects of signaling pathway inhibitors on ATP-inhibited proliferation (A)...

Ngày tải lên: 07/03/2014, 12:20

... TRAIL on the liver carcinoma cells QGY-7703 To investigate the apoptotic function of TRAIL containing the extracellular domain (amino acids 114–281) of the human liver cancer cell line, QGY-7703 ... in the hepatocellular carcinoma cells, QGY-7703, we treated these cells with eight different agents, at increasing concentrations, with and without TRAIL, then analysed...

Ngày tải lên: 23/03/2014, 17:22

... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil ... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in...

Ngày tải lên: 07/08/2014, 15:20

... persistently HBV expressing cell line HepG2.215 and its parent cell line, a non-HBV expressing cell line HepG2 We found that cIAP1 and cIAP2 were clearly increased in the HBV expressing cells but XIAP ... expression in the HBV expressing cells was first investigated by the comparison of the gene expression profile in the HepG2.215 and HepG2 cells using gene arra...

Ngày tải lên: 02/11/2012, 11:17

... in further studies Collectively, our studies demonstrate that miR-23a potently promotes the growth of the gastric adenocarcinoma cell line MGC803, providing the first proofof-concept that there ... L.-H Zhu et al miR-23a promotes gastric cancer growth promote the growth of gastric adenocarcinoma cell line MGC803 by targeting directly the interleuki...

Ngày tải lên: 18/02/2014, 04:20

... to bind lipid compounds within the different endolysosomal compartments [23] In this study, we examined whether iron loading of the liver epithelial cell line HepG2 in uenced the expression of ... stress, cell growth and lipid metabolism in the iron loaded HepG2 The results of the study revealed a new link between iron loading and lipid...

Ngày tải lên: 19/02/2014, 16:20

... Identification of eEF1A as a nuclear protein specifically related to the cytotoxicity of GT oligomer in cancer cells In order to identify the nuclear proteins that specifically recognize cytotoxic GT oligomers, ... by cytotoxic GT oligomers and their selective binding to nuclear eEF1A In fact, in normal human lymphocytes no appreciable bi...

Ngày tải lên: 21/02/2014, 00:20