Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants
Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants
... focused on the analysis of DNA fragments; and the second part (chapter and chapter 5) focused on the analysis of organic pollutants Several novel capillary electrophoresis (CE) techniques had ... various applications, the CE applications in DNA analysis and monitoring of pollutants are of significant importance 1.3.1 CE Application in DNA Analysis...
Ngày tải lên: 14/09/2015, 11:40
Báo cáo hóa học: " Editorial Novel Techniques for Analysis and Design of Cross-Layer Optimized Wireless Sensor Networks" docx
... construction of backbones for wireless sensor networks, that is, subsets of nodes that span the network, and all other nodes are within one hop from one of them Such structures can be used for a million ... push forward Note that the work applies not only to sensor networks, but to general wireless networks as well, and should be read with this in mind You have got them...
Ngày tải lên: 22/06/2014, 19:20
synthesis and application of dna-templated silver nanowires
... of the adsorption sites gradually on the nanowires 3.2.2 Response and recovery of the DNA-templated silver nanowires exposed to ammonia The response and recovery of the DNA-templated silver nanowires ... carried out at room temperature Results and discussions 3.1 Fabrication of the DNA-templated silver nanowires The fabrication of DNA-templated silver...
Ngày tải lên: 20/03/2014, 13:08
BÁO CÁO-DNA vaccine and Application of DNA vaccine in Fisheries
... Photo Album by Activated User DNA vaccine is DNA sequence used as a vaccine This DNA sequence code for antigenic protein of pathogen by Activated As this DNA inserted into cells it is User translated ... into DNA plasmid form Recombinant DNA Inject DNA vaccine into Fish G-gene construct shows good surface expression, which is believed to be a key feature to the effectiv...
Ngày tải lên: 18/05/2015, 18:30
Applications of capillary electrophoresis in the analysis of natural products
... effective components in natural products Hence, the major aim of this thesis is to expand the analytical applicability of CE in the analysis of natural products The range of natural products is quite ... The migration of cations results in the migration of whole buffer solution through the capillary; this migration is the EOF Since the drivin...
Ngày tải lên: 11/09/2015, 14:27
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA-binding activity ... confirm that the assay specifically measures HSF1 DNA-binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombi...
Ngày tải lên: 18/02/2014, 14:20
The development of acidic protein aptamers using capillary electrophoresis methods and their use in surface plasmon resonance
... also contains the ligand The nanoparticle binds to the analyte which causes an increase in mass upon binding to the ligand on the surface of the sensor and causing a boost in signal Another mass ... globulin proteins by comparing the peak height of the DNA peaks71 24 1.5 Objectives and Scope of the dissertation The focus of this thesis will be on the d...
Ngày tải lên: 10/09/2015, 09:22
Novel methods for quantitative analysis and evaluation of effects of chronic exposure to microcystins by capillary electrophoresis and metabolomic studies
... NOVEL METHODS FOR QUANTITATIVE ANALYSIS AND EVALUATION OF EFFECTS OF CHRONIC EXPOSURE TO MICROCYSTINS BY CAPILLARY ELECTROPHORESIS AND METABOLOMIC STUDIES GRACE BIRUNGI ... –DEVELOPMENT OF METHODS OF ANALYSIS 48 2.0 Development of CE Methods for the Determination of Cyanotoxins 48 2.1 CZE and MEKC Methods for Determination of Mi...
Ngày tải lên: 11/09/2015, 10:14
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 1
... Introduction……………………………………… …… 1~ 57 1. 1 Basic Theory of Capillary Electrophoresis ……………………….… 1~ 6 1. 2 Electroosmotic Flow (EOF)…………………………………………… 6 ~13 1. 3 Different Modes of CE…………………………………………….…… 13 ~20 1. 3 .1 Capillary ... Optimization………………………… …… .11 4 ~11 5 4.4.4 Linearity, Repeatability and Limits of Detection………… … 11 5 ~11 9 4.4.5 Application…………………………………………...
Ngày tải lên: 14/09/2015, 10:36
Development of methods to improve sensitivity and portability of capillary electrophoresis for the analysis of stabilizers and drugs 2
... just ranges from to 20 nl To increase the sensitivity, two approaches, either to increase the amount of analyte added to the capillary or to improve the sensitivity of the detector, may be applied ... though they migrate opposite to the direction of the EOF, are also transported to the detector (on the cathode side) Since their migration velocitie...
Ngày tải lên: 14/09/2015, 10:37
Development and applications of novel solvent minimized techniques in the determination of chemical warfare agents and their degradation products
... DEVELOPMENT AND APPLICATIONS OF NOVEL SOLVENT- MINIMIZED TECHNIQUES IN THE DETERMINATION OF CHEMICAL WARFARE AGENTS AND THEIR DEGRADATION PRODUCTS LEE HOI SIM NANCY (M.Sc.), NUS A THESIS ... determination of various chemical warfare agents and their degradation products This approach allows the miniaturization of the extraction proc...
Ngày tải lên: 14/09/2015, 14:08
Development and application of advanced proteomic techniques for high throughput identification of proteins
... DEVELOPMENT AND APPLICATION OF ADVANCED PROTEOMIC TECHNIQUES FOR HIGHTHROUGHPUT IDENTIFICATION OF PROTEINS HU YI (B.Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... analysis of proteins, i.e proteomics (Pandey and Mann, 2000; Tyers and Mann, 2003) Therefore, the advancement of proteomics relies largely on the development...
Ngày tải lên: 16/09/2015, 08:30
Development and applications of novel liquid phase microextraction techniques
... fiber-protected liquid- phase microextraction Headspace -liquid- phase microextraction Local anaesthetics Liquid chromatography Liquid- liquid extraction Liquid- liquid -liquid microextraction Limits of Detection ... 1.1 Historical Development of Microextraction Techniques 1.2 Principles and Applications of SME and Membrane-Based LPME Techniques 1.3 Hyphena...
Ngày tải lên: 16/09/2015, 17:11
Development and application of liquid phase microextraction techniques in the analysis of environmental pollutants
... drop -in- drop system The aqueous phase of the outer drop contained the analyte of interest and was continuously delivered and aspirated away throughout the sampling The analytical response of the instrument ... involves the use of hollow fiber combination with liquid- phase microextraction It can be categorized into two- ii phase microextraction, and thr...
Ngày tải lên: 17/09/2015, 17:20
nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 7
... Journal of Botany, 14 (1) , 67 -10 4 MacNae, W (19 68) A general account of the fauna and flora of mangrove swamps and forests in the Indo-West-Pacific region Advances in marine biology, 6, 73 - 270 Mahoney, ... Editor, Handbook for Restoring Tidal Wetlands, CRC Press, Boca Raton, Florida (20 01) , pp 11 9 15 5 Tomlinson, P B (19 86) The Botany of Mangroves C...
Ngày tải lên: 22/09/2015, 15:19