Regulation of sla2p by activity in endocytosis and actin organization by the ark1 prk1 family of kinases
... phosphorylation by Prk1p and possibly Ark1p kinase These kinases constitute a unique family of actin regulating kinase whose substrates include many components of actin machinery as well as endocytic and ... depolymerization Actin bundling proteins such as Sac6p and Abp140p can be found coating the actin cables, and bind actin filaments together to form a cable...
Ngày tải lên: 14/09/2015, 08:50
... both a novel C-terminal actin- binding submodule (CABS) containing a novel actin monomer binding verprolin homology C-terminal (VH2-C) domain and a second submodule comprising the previously characterized ... actinbinding domain (this actin- binding domain has not yet been mapped) [23] We name the actin- binding domain that we have identified VH2-C and VH2-...
Ngày tải lên: 18/02/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf
... hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase- 2) requires Ca2+ for fibronectin and heparin binding Binding properties of recombinant gelatinase A C domain to ... autocatalytic step of the activation by binding to the 64 kDa intermediate form of MMP-2 [52] Binding and activation of MMP-2 was abrogated in the presence of avb3 integrin-bindi...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... BA & Maki M (20 03) Analysis of epidermaltype transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytes using monoclonal antibodies J Dermatol Sci 32 , 95–1 03 ... Baxa U & Steinert P (20 03) Roles of calcium ions in the activation and activity of the transglutaminase enzyme J Biol Chem 278, 238 34– 238 41 30 Hitomi K, Presland RB,...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx
... AT activity in both cortex and medulla of human kidneys and show that cortical and medullary lyso-PAF AT share similar biochemical properties indicating common cellular sources Materials and ... system of creatinine phosphate and creatinine phosphate kinase exerted the same inhibitory effect on both standard PAF and the lipid product of similar aggregatory activity Mil...
Ngày tải lên: 17/03/2014, 03:20
Paper Manufacture in Central and Eastern Europe Before the Introduction of Paper-making Machines pptx
... introducing into the technique of making paper by hand in Europe and characteristics of European hand-made papers The genuinely European art of making paper by hand developed in Fabriano and ... middle of the 19th century in eastern parts of Europe, where paper- making machines were slowly introduced into paper industry Some main alterations in paper...
Ngày tải lên: 01/04/2014, 00:20
research report 'using the activity in pairs and in groups to teach writing in english'
... given and the procedure is repeated - When the work has finished, the students open them and, in writing, join the fragments of information together to make it more interesting and logical - The ... - Ask the students to get into pairs Give out copies of one text to half of the class and the other text to the half - Ask them to list all the words in...
Ngày tải lên: 29/06/2014, 19:15
Báo cáo y học: "Expression of cytokine mRNA and protein in joints and lymphoid organs during the course of rat antigen-induced arthritis" potx
... preparation In an independent AIA study, samples of knee-joint SM, inguinal LNs, and spleen were obtained from rats killed at six time points: day 0, hours, day 1, day 3, and day of AIA Cytokine protein ... antigen-induced arthritis the course of AIA (Table 1, in conjunction with Fig and Table 3, underlining the predominantly local character of AIA Cytokine mR...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo khoa hoc:" Genetic relationship between cyclic ovarian activity in heifers and cows and beef traits in males" ppt
... 3–4; 5–6 and 7+ years) Cyclicity and beef traits: genetic relationship Twinningt an Final ageiktn eijktn 279 = fixed effect of type of birth t (2 levels: single or twin) = random additive genetic ... Within the French Charolais breed, a favourable genetic relationship has been revealed between the female growth rate and its ovarian cyclic activity at puberty and af...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: "Vascular Endothelial Growth Factor (VEGF) isoform expression and activity in human and murine lung injury" pps
... In order to investigate this possibility we repeated this analysis in snap frozen lung tissue from our multiple dose LPS-induced lung injury model at day post initial injury, reflecting early ... key source [5,6,34] Several lines of in vitro evidence have pointed to a possible role for VEGF in lung repair and recovery following injury[19,29,35,36] In one LPSinduced murine...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Influence of genetic variations in TLR4 and TIRAP/Mal on the course of sepsis and pneumonia and cytokine release: an observational study in three cohorts" pdf
... LPS Concentrations of TNF-α and IL-6 in cell supernatants of patients bearing the wild-type phenotype and of carriers of TIRAP/Mal or TLR4 polymorphisms showed an increase of cytokine levels Individuals ... potentially linked to an altered stress response and may therefore influence severity of sepsis However, data on the influence of TIRAP/Mal va...
Ngày tải lên: 13/08/2014, 20:22
Báo cáo sinh học: " Further insights of the variance component method for detecting QTL in livestock and aquacultural species: relaxing the assumption of additive effects" pptx
... structures; then we performed the testing regimes used first for detecting the presence of a segregating QTL (with or without using information of dominance) and then we made inferences about the mode of ... heritability of the QTL and the actual bias is clearly a function of the magnitude of the dominance variance explained by the QTL (Fig 3) Due to...
Ngày tải lên: 14/08/2014, 13:21
unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh tt
... NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES POST-GRADUATE DEPARTMENT == == = == = == = == = == = == NGUYỄN THANH TÂM UNMARKED PLURAL NOUNS IN ENGLISH AND THEIR DIFFICULTIES FOR THE 1ST YEAR STUDENTS ... find out what teaching methods they are using when dealing with unmarked plural nouns in English, what difficulties they find from their...
Ngày tải lên: 28/02/2015, 11:54
unmarked plural nouns in english and theis difficulties for the 1st year students at the faculty of tourism, honoi university of culture = danh từ số nhiều không có dấu hiệu nhận dạng trong tiếng anh
... teaching English to the 1st year students at the Faculty of Tourism at HUC to find out what teaching methods they are using when dealing with unmarked plural nouns in English, what difficulties they ... out the difficulties in using unmarked plural nouns in English faced by the 1st year students at the Faculty of Tourism, HUC a...
Ngày tải lên: 28/02/2015, 11:54