Accurate and sensitive determination of selected contaminants from food packaging materials

... implementation of food safety policies This thesis will cover two broad areas of contaminants from food contact materials: Determination of the migration of bisphenolic monomers from canned coatings into food, ... migration of various types of toxic contaminants from food packaging materials into oily, aqueous and acidic food matrices The first part of...

Ngày tải lên: 14/09/2015, 08:39

... this article as: Cao et al.: Prognosticators and Risk Grouping in Patients with Lung Metastasis from Nasopharyngeal Carcinoma: A more accurate and appropriate assessment of prognosis Radiation ... CY, Huang AT: Examining prognostic factors and patterns of failure in nasopharyngeal carcinoma following concomitant radiotherapy and chemotherapy: impa...

Ngày tải lên: 09/08/2014, 09:21

... FEASIBILITY STUDY OF REMOVAL OF SURFACE CONTAMINANTS FROM SOLID SURFACES USING WATER JETS WITH BUBBLES AND ULTRASOUND MUHAMMAD FADZLI B HASSAN (B.ENG (HONS), NATIONAL UNIVERSITY OF SINGAPORE) ... The Measurement of Impact and Shear Stresses of Impinging Bubbles 146 7.6 Investigation V: The removal of surface contaminants from an etched su...

Ngày tải lên: 08/09/2015, 18:19

... for 3.0 and 5.0 % of total VS concentrations could not be conducted because of low VS concentration of sewage sludge 20 mL of seed sludge and appropriate amounts of food waste and sewage sludge ... produce moles of hydrogen with mole of n-butyrate or moles of hydrogen with mole of acetate from mole of hexose In most cases using soluble defined substra...

Ngày tải lên: 05/09/2013, 08:40

... s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a kcat of 7.1 ± 0.7 s)1, Km of 0.182 ± 0.027 mm and kcat ⁄ Km of 3.9 · 104 m)1Æs)1 toward NADP Different from ... metabolism of H pylori Recently, the three-dimensional structures of AroE from several bacteria such as E coli, Methanococcus jannaschii, and H influenzae, and YdiB...

Ngày tải lên: 19/02/2014, 05:20

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...

Ngày tải lên: 20/02/2014, 02:21

... WAVEQMNYILGDNK AWAWALGWDDK GYHENA WPLDYFL TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA ... Double-stranded cDNA was synthesized from the mRNA with a cDNA synthesis kit (TaKaRa, Tokyo, Japan) and used as an abalone cDNA library cDNAs encoding abalone cellulase were amp...

Ngày tải lên: 20/02/2014, 23:20

... heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e agonistically as well as antagonistically, completely inactive The lack of antagonistic activity may be explained by the fact ... a CaF2 crystal and allowed to stand at room temperature until all free water was evaporated After this, IR spectra were recorded at room temperature and at 37 °C Usually, the or...

Ngày tải lên: 21/02/2014, 00:20

... not been functionally proved and the lability of substrate and product rule out any cocrystallization The setting of a helices and b-strands causes very similar CD spectra for this class of enzymes ... mutagenesis MATERIALS AND METHODS Expression vector The FLS cDNA from satsuma mandarin fruits, C unshiu [30], was excised with EcoRI and XhoI from the Bluescript vector...

Ngày tải lên: 21/02/2014, 03:20

... from the author IZA Discussion Paper No 3096 October 2007 ABSTRACT Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball* This paper examines how the ... Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball Eric D Gould Hebrew University and IZA Ey...

Ngày tải lên: 22/02/2014, 09:20

... although, as V volvacea produces at least one other laccase isoform in addition to lac1 [1], this and possibly other laccase isoforms may be contributing to the total laccase activity detected at the ... primers The putative N-glycosylation site is boxed; *; stop codon The putative polyadenylation signals (TATAAA and CATAAA) are in white on a black background Ó FEBS 200...

Ngày tải lên: 07/03/2014, 15:20

... decrease of activity of C5a peptidase at temperatures above 43 °C is associated with the beginning of thermal unfolding Kinetic parameters of C5a peptidase: hydrolysis of peptide and pNA substrates ... available for C5a peptidase from pathogenic Streptococcus pyogenes One of the aims of this study was to map the prosequence region of C5a peptidase a...

Ngày tải lên: 08/03/2014, 16:20

... Citation The 2010 National Healthcare Quality Report and National Healthcare Disparities Report are available online at http://www.ahrq.gov/qual/qrdr10.htm Healthcare Quality and Disparities in Women: ... Healthcare Quality and Disparities in Women: Selected Findings From the 2010 National Healthcare Quality and Disparities Report...

Ngày tải lên: 14/03/2014, 14:20

... stoichiometries of participation of water, cations and anions in specific and non-specific binding of lac repressor to DNA Possible thermodynamic origins of the ‘‘glutamate effect’’ on protein–DNA ... function optimally Effects of mutations The point mutations are not in the immediate vicinity of the active site situated at the bottom of the positively charge...

Ngày tải lên: 16/03/2014, 06:20

... PCR and sequencing A QuickPrepÒ Micro mRNA Purification Kit (Amersham Bioscience) was used for isolation of mRNA from P hilaris larval midguts First-strand cDNA synthesis from the isolated mRNA and ... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P h...

Ngày tải lên: 17/03/2014, 10:20