measurements and the determination of the state of a system
Magnetic resonance spectroscopy correlation with histological analysis in gliomas and structure determination of a hypothetical protein
... compounds may indicate loss of energy and activity in brain All these facts, loss of NAA, presence of acetate and absence of mono-sacchride and myo-inositol of sample NNI1, indicate that the major activities ... physiologically relevant range Most studied metabolites in brain are Acetate, N-Acetyl aspartate (NAA), N-Acetylaspartylglutamate (NAAG), Alanine, Choline, Creatine, Glutamate, Glycine, Myo-inositol, Lactate, ... for clarification of normal functions of the brain and clinical diagnosis An advantageous property of NMR that plays an important role in medical applications is the low energy of the radio frequency...
- 92
- 284
- 0
Genealogies and the State of Nature
... insincerity The Origin of Species and The Descent of Man were subversive only because of their conflict with a particular view of the status and provenance of the human race, and one that was at the time ... appeal to real explananda (Many combinations are possible Hume’s in The Natural History of Religion was explanatory and subversive Williams’ is explanatory and vindicatory, as was mine Hume’s state -of- nature ... which he was enthroned The idea was that he would keep the peace and obviate the danger of early and violent death, but early and violent death is exactly what I and my comrades are now facing,...
- 20
- 585
- 0
Multidimensional Poverty and the State of Child Health in India pdf
... Andhra Pradesh Arunachal Pradesh Assam Bihar Chhattisgarh Goa Gujarat Haryana Himachal Pradesh Jammu and Kashmir Jharkhand Karnataka Kerala Madhya Pradesh Maharashtra Manipur Meghalaya Mizoram ... Orissa Assam Arunachal Pradesh Mizoram Tripura Bihar Nagaland West Bengal Madhya Pradesh Haryana Rajasthan Uttar Pradesh Manipur Jammu and Kashmir Chhattisgarh Maharashtra Karnataka Gujarat Punjab ... 10%-20%: Andhra Pradesh, Tripura, Tamil Nadu, Gujarat, Karnataka, Nagaland, Maharashtra and Haryana States with abject poverty of less than 10%: Uttaranchal, Manipur, Jammu and Kashmir, Mizoram, Sikkim,...
- 40
- 732
- 0
the politics of child sexual abuse emotion social movements and the state aug 2009
... satanic ritual abuse as the paradigmatic case, and show that concern ran high as a result of sensationalist media coverage and the claims of gullible or self-promoting “experts,” rather than as ... molestation as part of a seamless web of sexual assault against women She used the term “father-rape” to emphasize both the similarity between rape of adults and children and the cultural legitimation ... confrontation with the state; rather, they moved to confronting the state in its therapeutic arenas of domination As Tarrow argues, they use the frameworks provided by the state in this case therapeutic...
- 273
- 305
- 0
benston et al - following the money; the enron failure and the state of the corporate disclosure (2003)
... scandals was not a major flaw in the standards themselves, but primarily a failure either of the company to comply with the standards or of the regulator to enforce them Indeed, what was perhaps ... inadequate audits and gross violations of GAAP, because these are not simply a private matter The Enron debacle and the misstated financial reports of other corporations have imposed substantial ... External auditors are supposed to ensure that their audits are conducted in accordance with GAAS and that the financial figures are prepared in accordance with GAAP An important aspect of the audit...
- 135
- 207
- 0
skidelsky & wigstrom (eds.) - the economic crisis and the state of economics (2010)
... background as a physicist and a financial practitioner Modern Mathematical Finance The birth of modern mathematical finance is the Black and Scholes paper of 1973 In the Black and Scholes model of the ... relevance of several classical axioms for understanding the real world The classical ergodic axiom that assumes that the future is known and can be calculated as the statistical shadow of the past ... economists” of the east and west coasts Eugene Fama, who is a Professor of Finance at Chicago University, and the godfather of the Efficient Market Theory, encapsulated the Chicago view when he said that...
- 140
- 325
- 0
preferred citation; glasberg, davita silfen. the power of collective purse strings; the effect of bank hegemony on corporations and the state
... Financial, and Morgan Guaranty (as agent for itself and 143 other banks) entered into a loan and guaranty agreement Under this agreement the unsecured loans as well as the secured loans advanced ... parties, and government agencies—an assumption that bears examination rather than assertion as fact Furthermore, pluralists ignore the allegiances and interests of state leaders, arguing ― 14 ― that ... purchase all other resources of production, commerce, and the management of the state Money capital is cash The earliest analyses of financial institutions examined the role banks played in the...
- 285
- 301
- 0
Tài liệu COSMIC MAPS, PROPHECY CHARTS, AND THE HOLLYWOOD MOVIE, A BIBLICAL REALIST LOOKS AT THE ECLIPSE OF OLD TESTAMENT NARRATIVE* ppt
... read literally and historically as a true and accurate account of God's acts in real historical events It was assumed that the realism of the biblical narratives was in fact an indication that ... of the earth's surface at various places and forms a volcano A whole ecological system then forms around the volcano That system is analogous to theology Liberalism's view of the religion and theology ... place of the meaning of the text Let me give one example In Exod 7:20, "Moses and Aaron did just as the LORD had commanded He raised his staff in the presence of Pharaoh and his officials and...
- 17
- 576
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria...
- 12
- 598
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects ... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia...
- 88
- 581
- 0
Báo cáo khóa học: Biochemical and molecular characterization of a laccase from the edible straw mushroom, Volvariella volvacea docx
... min; then a final extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... standards (Bio-Rad) The isoelectric point of the enzyme was determined with the Phastsystem using PhastGel IEF 3–9 operated for 410 Vh and standard pI markers (Pharmacia) The standard assay conducted ... developmental cycle: early, middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage...
- 11
- 703
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... between [Ala9]SP and [Gly9]SP on the one hand, and [b2-HAla9]SP and [HGly9]SP on the other hand Indeed, the higher pharmacological potency of [b2-HAla9]SP compared to [HGly9]SP suggests that the methyl ... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit ... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact...
- 11
- 860
- 0
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf
... induced against the linear isoform of the HNE peptide Although the binding pattern may be somewhat blurred by these antibodies and by the polyclonal nature of the sera, the importance of residues ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular ... microtiter plates increased at high pH (Fig 3A) Under the basic conditions optimal for coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result...
- 13
- 492
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not...
- 8
- 465
- 0
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... N-Terminal amino-acid sequencing analysis indicated that the mature protein of P hilaris cellulase was a truncated form, which lacked a signal peptide composed of the first 21 amino acids Therefore, the ... enzymes, such as xylanase and mannanase P hilaris cellulase was proposed to belong to GHF and the signature sequence of GHF was found in the aminoacid sequence (Fig 3) GHF is the largest GHF and includes ... Biochim Biophys Acta 1576, 246–254 Da Lage, J.L., Maczkowiak, F & Cariou, M.L (2000) Molecular characterization and evolution of the amylase multigene family of Drosophila ananassae J Mol Evol...
- 6
- 361
- 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc
... when the values of all the parameters of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the set N are strictly equal to their counterparts ... physical/geometrical and numerical parameters to which the model appeals The physical/geometrical parameters of the SM form none other than the set p, whereas the numerical parameters of the SM can ... 1992), has a corollary (Wirgin, 2004): when the values of all the parameters, except PK of the set P are strictly equal to their counterparts in the set p and the values of all the parameters of the...
- 26
- 467
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... at the beginning of the chromatogram (peaks 1*, 2*, 3*, and in Fig 5A) For peaks and 2, molecular masses of 2025 and 2041 Da were obtained as before (Table 1) The molecular mass of peak 3* was ... additional 162 Da) in the material of peak (Fig 3A, B) and both galactose and fucose (the additional 146 Da) residues in peak (the data for the Ru strain are shown in Fig 4) These results correlated closely ... for films of the intact and trypsin-treated Ru PVX and the intact ST mutant preparations To compare the waterabsorbing capacity of the different PVX variants, we measured their FTIR spectra in dry...
- 10
- 398
- 0
Báo cáo Y học: Heterologous expression and folding analysis of a b-tubulin isotype from the Antarctic ciliate Euplotes focardii ppt
... CCT were quantitated by the use of a phosphorimager and expressed as a fraction of the maximum amount of bound labeled tubulin and plotted as a function of the ratio of labeled : unlabeled tubulin ... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... nondenaturing PAGE; the ratios of labeled to unlabeled tubulins are indicated on the top of each lane and the arrow indicates the position of the b-tubulin/CCT complex (B) The amounts of the tubulin...
- 7
- 500
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... Sialylated LPS in Haemophilus influenzae (Eur J Biochem 269) 4011 Analytical methods and methylation analysis Sugars were determined as their alditol acetates and partially methylated alditol acetate ... strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H influenzae to elaborate sialylated ... signals were observed for the axial and equatorial H-3 H-resonances of the sialic acid residue at 1.81 and 2.76 p.p.m., respectively (Fig 4) Integration of the H-3 H-resonances of the sialic acid...
- 11
- 579
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008