Spray drying of elderberry (sambucus nigra l ) juice to maintain its phenolic content

Spray drying of elderberry (sambucus nigra l ) juice to maintain its phenolic content

Spray drying of elderberry (sambucus nigra l ) juice to maintain its phenolic content

... and total phenol content depend on the type of wall materials and their ratio to total solid content of the juice The actual phenol content was calculated using the following formula: Downloaded ... indication of a dilution effect from the wall materials For example, the highest L value (thus lighter color) was found at 1:1 ratio of maltodextrin, while its total phenol...

Ngày tải lên: 13/09/2015, 11:22

13 301 0
Báo cáo Y học: A complex fruit-specific type-2 ribosome-inactivating protein from elderberry (Sambucus nigra) is correctly processed and assembled in transgenic tobacco plants doc

Báo cáo Y học: A complex fruit-specific type-2 ribosome-inactivating protein from elderberry (Sambucus nigra) is correctly processed and assembled in transgenic tobacco plants doc

... expressed in tobacco possesses a fully active A- and B-chain, the agglutination activity and carbohydrate-binding specificity, and RNA N-glycosylase activity of SNA-If and rSNA-If were compared As shown ... same activity and specificity as that of the elderberry fruit protein Assays of the RNA N-glycosylase activity using ribosomes from both animal and plant origin as...

Ngày tải lên: 31/03/2014, 23:20

10 256 0
báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf

báo cáo khoa học: "Genetic variation of g-tocopherol methyltransferase gene contributes to elevated a-tocopherol content in soybean seeds" pdf

... concentration and g-tocopherol content (Table 1), indicating that the candidate gene is directly related to conversion of g-tocopherol to a-tocopherol Fine mapping using F5 lines showed that g-TMT3 ... most of the tocopherols are g-tocopherol or δ-tocopherol; in sunflower (Helianthus annuus) and safflower (Carthamus tinctorius) seeds, the content of a-tocopherol is...

Ngày tải lên: 11/08/2014, 11:21

17 432 0
Báo cáo y học: " Failure of a non-authorized copy product to maintain response achieved with imatinib in a patient with chronic phase chronic myeloid leukemia: a case report" ppsx

Báo cáo y học: " Failure of a non-authorized copy product to maintain response achieved with imatinib in a patient with chronic phase chronic myeloid leukemia: a case report" ppsx

... Hematologic parameters at baseline, following change to imatib and return to imatinib therapy Laboratory value January 2007 Imatinib 400 mg/day March 2007 Imatib 400 mg/day July 2007 Imatinib ... the patient resumed imatinib at a daily dose of 600 mg per day In July 2007, after approximately two months of therapy with imatinib, laboratory values revealed a return t...

Ngày tải lên: 11/08/2014, 17:21

3 209 0
Báo cáo lâm nghiệp: "Paternity analysis of Populus nigra L. offspring in a Belgian plantation of native and exotic poplars" doc

Báo cáo lâm nghiệp: "Paternity analysis of Populus nigra L. offspring in a Belgian plantation of native and exotic poplars" doc

... flowering and no evidence of mating between a female P nigra and a male P nigra cv Italica growing about Paternity analysis of P nigra offspring 350 m apart in Scotland However, flowering of P nigra cv ... located in the total plantation) were analysed using 14 SSR loci (Tab II) Furthermore, P nigra cv Italica, located outside the poplar plantation was also inc...

Ngày tải lên: 07/08/2014, 16:20

8 286 0
Advantages and challenges of the spray drying technology for the production of pure drug particles and drug loaded polymeric carriers

Advantages and challenges of the spray drying technology for the production of pure drug particles and drug loaded polymeric carriers

... ACCEPTED MANUSCRIPT Advantages and challenges of the spray- drying technology for the PT production of pure drug particles and drug- loaded polymeric carriers SC RI Alejandro Sosnik1* and Katia P Seremeta2,3,4 ... advantages and challenges of the spray- drying method for the production of pure drug particles and drug- load...

Ngày tải lên: 02/09/2015, 13:31

70 488 0
Development of oil loaded alginate composite microspheres by spray drying

Development of oil loaded alginate composite microspheres by spray drying

... containing alginate and fish oil for spray drying 2) To optimize spray drying conditions for the production of microspheres containing alginate as wall material 3) To investigate the effect of alginate ... hypothesized that the use of alginates as wall material can enhance the oil- loading capacities of microspheres produced by spray drying In addition, the...

Ngày tải lên: 30/09/2015, 06:28

198 485 0
Anchorage and resistance to uprooting forces of eelgrass (Zostera marina L.) shoots planted in slag substrates

Anchorage and resistance to uprooting forces of eelgrass (Zostera marina L.) shoots planted in slag substrates

... where eelgrass plants were collected, the Yoshina Tidal Flat in Seto Inland Sea, which has well-established eelgrass beds Resistance to uprooting forces The resistance to uprooting forces of the eelgrass ... ability of slag to anchor the roots of the eelgrass plants and (3) to investigate how sedimentation of fine particles affects anchoring of the...

Ngày tải lên: 05/09/2013, 09:38

11 295 0
Tài liệu Tỷ Suất Lợi Nhuận -- Rate of Returns Trọng-Quyen L. Nguyen Tỷ lệ Bất Biến Tỷ ppt

Tài liệu Tỷ Suất Lợi Nhuận -- Rate of Returns Trọng-Quyen L. Nguyen Tỷ lệ Bất Biến Tỷ ppt

... phân tích tỷ lệ, ta nên ý đến khác biệt lợi (benefits) lợi thêm (additional benefits) Như trình bày, học lúc lợi không học Nhưng tỷ lệ lợi thêm cho không giống nhau, tỷ lệ lợi ích tỷ lệ giảm thiểu ... hoc thí sinh hưởng lợi không học bài, tỷ lệ lợi ích học cho thay đổi giảm dần Tiếng đầu tiên, tỷ lệ lợi ích 22điểm/1giờ; tiếng thứ hai, tỷ lệ lợi ích...

Ngày tải lên: 20/01/2014, 09:21

9 423 0
Báo cáo " Effect of pomelo (citrus grandis (l). osbeck) peel extract on lipid-carbohydrate metabolic enzymes and blood lipid, glucose parameters in experimental obese and diabetic mice " doc

Báo cáo " Effect of pomelo (citrus grandis (l). osbeck) peel extract on lipid-carbohydrate metabolic enzymes and blood lipid, glucose parameters in experimental obese and diabetic mice " doc

... (A) and CPT(B) in treated obese mice (↑ Increases) 3.4 Effect of STZ on ND-fed and HFD fed mice Injection of STZ (120 mg/kg) into obese mice significantly increased blood glucose concentration ... proved in the STZ induced diabetic mice Table Blood glucose and insulin concentration after days of buffer or STZ injection Biochemical estimation Blood...

Ngày tải lên: 14/03/2014, 10:20

9 511 1
Báo cáo khoa học: Crystal structure of archaeal highly thermostable L-aspartate dehydrogenase/NAD/citrate ternary complex doc

Báo cáo khoa học: Crystal structure of archaeal highly thermostable L-aspartate dehydrogenase/NAD/citrate ternary complex doc

... nicotinamide ring of NAD Based on the structure of citrate, we modeled the l-aspartate molecule into the active site of A fulgidus l-aspDH (Fig 4B) and then minimized the energy of the complex using ... The crystal structure of a hyperthermophilic archaeal TATA-box binding protein J Mol Biol 264, 1072–1084 Lim JH, Yu YG, Han YS, Cho S, Ahn BY, Kim SH & Cho Y (1997) The...

Ngày tải lên: 16/03/2014, 05:20

11 323 0
Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

... synthesize one of the elderberry type-2 RIPs/lectins Therefore, the presence of mRNAs encoding PR-1, PR-2, PR-3 and proteinase inhibitor II was verified by Northern blot analysis In none of the ... accordingly is capable of depurinating in planta part of the ribosomes in IRIPexpressing tobacco on TMV infection (as could be demonstrated by an in planta depurina...

Ngày tải lên: 23/03/2014, 12:20

8 398 0
The Healthy Life, Vol. V, Nos. 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg L ppt

The Healthy Life, Vol. V, Nos. 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg L ppt

... Project Gutenberg' s The Healthy Life, Vol V, Nos 24-28, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever You may copy it, give it ... it away or re -use it under the terms of the Project Gutenberg License included with this eBook or onlin...

Ngày tải lên: 29/03/2014, 13:20

815 2,1K 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

... GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ (-20 downstream oligo) 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT ... polymerase 20 Rat pol β antibody (ng) Fig Effect of anti-(rat DNA polymerase b) IgG on the activity of mungbean DNA p...

Ngày tải lên: 30/03/2014, 08:20

19 350 0
Báo cáo sinh học: " Thiol-reactive reagents inhibits intracellular trafficking of human papillomavirus type 16 pseudovirions by binding to cysteine residues of major capsid protein L" pot

Báo cáo sinh học: " Thiol-reactive reagents inhibits intracellular trafficking of human papillomavirus type 16 pseudovirions by binding to cysteine residues of major capsid protein L" pot

... attempted to know whether thiol-reactive reagents affect infectivity of HPV16 PVs (16Pvs) by binding to the L1 cysteine residues Results Infectivity of the 16PVs that have bound to thiol-reactive reagents ... streptavidin, was found to bind to the free thiol of the cysteine residues of L1 of 16PV, which was produced by packaging of a reporter plasmi...

Ngày tải lên: 18/06/2014, 18:20

11 270 0
w