A semantic approach for scalable and self organized context aware systems

... A SEMANTIC APPROACH FOR SCALABLE AND SELF- ORGANIZED CONTEXT- AWARE SYSTEMS GU TAO NATIONAL UNIVERSITY OF SINGAPORE 2005 A SEMANTIC APPROACH FOR SCALABLE AND SELF- ORGANIZED CONTEXT- AWARE SYSTEMS ... characteristics of context information such as uncertainty, and provide a common platform for sharing and processing context information acros...

Ngày tải lên: 12/09/2015, 21:26

... The AMALGHMA (Advanced Measurement Algorithms for Hardware Architectures) tool has been implemented for automating the measuring activities AMALGHMA adopts a set of statistical methods, such as ... the hardware model to carry out the performance and energy consumption estimation A tool, named PECES, was implemented for automatizing the method Additionally, a measuring pl...

Ngày tải lên: 21/06/2014, 11:20

... CatD (10 ng) Values are mean ± SD, n ¼ (Insertion: 10 ng CatE and CatD and ng antigenic peptide were incubated on an ELISA plate CatE and CatD antibodies were used for the detection at dilutions ... ⁄ well) Monospesific antibodies were preincubated with different concentrations of CatE or CatD, before standard ELISA ELISA was performed as described in Experimental procedures The incr...

Ngày tải lên: 07/03/2014, 09:20

... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... the analysis are: Austria, Belgium, Finland, France, Germany, Greece, Ireland, Italy, the Netherlands, Portugal and Spain Panel B: OLS panel regre...

Ngày tải lên: 15/03/2014, 10:20

... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...

Ngày tải lên: 18/06/2014, 15:20

... this article as: Lehrer et al.: Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive ... efficient unimpaired performance Figure displays a graphic representation synthesized from the Levin, Kleim and Wolf approach Kwakkel takes a...

Ngày tải lên: 19/06/2014, 08:20

... transformed data sets achieve better performance and faster convergence in general There are many transformation procedures that can be applied to a data set [22] In this study, the all data sets (i.e., ... Jang in 1991 [13, 14] More information regarding the architecture and the performance of ANFIS can be found in the literature [12] In what follows, first, performance of an MD sim...

Ngày tải lên: 21/06/2014, 20:20

... Experimental results on depth estimation and blind restoration of images In order to obtain the depth map and blind restoration of images, we need to estimate the surface gradients and the blur parameter ... labels for estimating the same was chosen as 10 Figures 7 (a) and S Sharma and ManjunathV Joshi (a) (b) (c) Figure 8: Depth map for vase (a) ground truth and...

Ngày tải lên: 21/06/2014, 22:20

... case of SR ARQ, the number of retransmissions of a packet is a random number between and Ntr Therefore, the latency and overhead resulting from SR ARQ are also random, with a maximum value determined ... rise to a fixed overhead and latency that are determined by the parameters of the RS code In the case of SR ARQ, the instantaneous overhead and latency are random; th...

Ngày tải lên: 21/06/2014, 22:20

... necessary information to increase their ability to analyse, plan, and react In spite of the large volume of data gathered from transactional databases (operational systems) and the existing information ... specification of the Planning System comprises two subsystems, one for the creation and analysis of alternatives and another for time-management The Planning subsystem for cre...

Ngày tải lên: 07/08/2014, 02:20

... Galaxy provides a framework for performing computational analyses, systematically repeating analyses, capturing all details of performed analyses, and annotating analyses Using Galaxy Pages, researchers ... metadata) - to repeat an analysis exactly When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step Galaxy’s metadata includes e...

Ngày tải lên: 09/08/2014, 20:22

... as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA Theoretical ... of the initial concept for comparative analysis between the DHD and CHD and and drafted the initial version of the manuscript GA dra...

Ngày tải lên: 13/08/2014, 16:20

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGC...

Ngày tải lên: 13/11/2014, 10:46

... A SYSTEMATIC APPROACH FOR PREFERENTIAL CRYSTALLIZATION- THERMODYNAMICS, KINETICS, OPTIMAL OPERATION AND IN- SITU MONITORING WANG XIUJUAN (B.Eng., M Eng., Tianjin University) A THESIS ... to present a systematic approach to integrate thermodynamics, crystal nucleation and growth kinetics, optimal control and in- situ monitoring to study prefere...

Ngày tải lên: 14/09/2015, 18:18

... 2011, Article No 32, pp - [4] P Angin, B Bhargava, R Ranchal, N Singh, L B Othmane, L Lilien, and M Linderman, “An Entity-Centric Approach for Privacy and Identity Management in Cloud Computing, ” ... selection approach with the data mining technique and the machine learning technique Figure decentralized IdM in cloud computing C Problem area As demonstrated in [5], c...

Ngày tải lên: 31/07/2013, 09:43