a solution approach for detecting and locating faults in facts environment
Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot
... BB) 4n monoallelic amplification (AAAA, AA), (AABB, AB), (BBBB, BB) 4n balanced amplification 5 (AAAAA, AA), (AAAAB, AB), (ABBBB, AB), (BBBBB, BB) (AAAAA, AA), (AAABB, AB), (AABBB, AB), (BBBBB, ... (BBB, BB) 3n somatic LOH 14 (AAAA, AA), (AAAA, AB), (BBBB, AB), (BBBB, BB) 4n somatic LOH 15 16 (AAAAA, AA), (AAAAA, AB), (BBBBB, AB), (BBBBB, BB) (AAAAAA, AA), (AAAAAA, AB), (BBBBBB, AB), (BBBBBB, ... BB) 5n monoallelic amplification 5n unbalanced amplification (AAAAAA, AA), (AAAAAB, AB), (ABBBBB, AB), (BBBBBB, BB) 6n unbalanced amplification 10 (AAAAAA, AA), (AAAABB, AB), (AABBBB, AB), (BBBBB,...
Ngày tải lên: 09/08/2014, 22:23
A semantic approach for scalable and self organized context aware systems
... A SEMANTIC APPROACH FOR SCALABLE AND SELF-ORGANIZED CONTEXT-AWARE SYSTEMS GU TAO NATIONAL UNIVERSITY OF SINGAPORE 2005 A SEMANTIC APPROACH FOR SCALABLE AND SELF-ORGANIZED CONTEXT-AWARE SYSTEMS ... in a context-aware infrastructure, including handling diverse and potentially unreliable sensor data, dealing with context acquisition and representation, maintaining system interoperability, and ... contexts, and automatically adapt to changing contexts This is known as contextaware computing Context information is a key for propagating and enmeshing computation into our lives, and exhibiting...
Ngày tải lên: 12/09/2015, 21:26
A Convivial Approach for Description and Manipulation of Deductive and Stratified Databases
... VI-SDB: A Convivial Approach for Description and Manipulation of Deductive and Stratified Databases convivial approach that aims to make the DDB manipulation non abstract and easy This approach permits ... 1991 [3] Barkaoui K., Boudrigua N., and Touzi A. , A Transition Net Formalism for Deductive Databases Efficiently Handling Quering and Integrity Constrains,” in Proceedings of Database and Expert ... explicit facts, making Extensional DataBase (EDB) and a set of deduction rules allowing deduction of new facts, making the Intentional DataBase (IDB) [6] A DDB is modelled by a definite program (a set...
Ngày tải lên: 21/12/2016, 10:31
an entity-centric approach for privacy and identity management in cloud computing
... control and dissemination control metadata ABC constructs an AB by putting together data, metadata, and adding a virtual machine After this stage, the AB becomes an active entity (since it has its ... descriptions to agent IDs [14] 179 168 B.1.4 Active Bundle Services: They include three agents: SSA, TEA, and ASA The first agent, SSA, maintains a database of information about ABs This information is ... used for encrypting and decrypting sensitive data and metadata included in ABs Each AB is described in SSA using the following information: name, decryption key, and the threshold trust level that...
Ngày tải lên: 31/07/2013, 09:43
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical significance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma J Gastroenterol ... Hepatol 15, 1333–1338 23 Nakanishi H, Tominaga K, Amano T, Hirotsu I, Inoue T & Yamamoto K (1994) Age-related changes in activities and localizations of cathepsins D, E, B, and L in the rat brain...
Ngày tải lên: 07/03/2014, 09:20
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... derive a testable equation linking bank loans and output The starting point is a simple aggregate demand Keynesian model augmented with two equations for the demand and supply of loans Assume that ... Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank risk and monetary policy", Journal of Financial Stability (forthcoming) [4] Angeloni, I., Kashyap, A. N and Mojon, ... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address...
Ngày tải lên: 15/03/2014, 10:20
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... collections as coinvestigator of the Swiss Ami clinical Trial, MG performed literature search, GS and TM participated in study design and coordination All the authors read and approved the final manuscript ... this must be addressed both in a suitable animal model and during a controlled clinical trial of acute myocardial infarction Basic and clinical scientists, as well as scientists working in the biotechnology ... Diagnostics, France) Migration and Invasion Assay A total of × 106 BM-MNC collected from acute myocardial infarction patients subjected to standard pharmacological therapy were resuspended in...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt
... components into an integrated design and can form a basis for a generalizable interactive rehabilitation methodology for stroke This paper proposes basic principles for such an integrated design as they ... hierarchy of training goals and general correlation The correlation shown is only general (and indicative), as the specific relationships among individual kinematic parameters will vary for each ... assistance and archiving allows for the documentation of movement performance that can be accessed and analyzed during and after a single set, or after multiple sets in order to convey performance...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx
... and faster convergence in general There are many transformation procedures that can be applied to a data set [22] In this study, the all data sets (i.e., training and checking data sets) were individually ... so-called ‘‘overtraining’’ term indicates that a given ANFIS adapts itself too well to the training data set in such a way that further improvement based on the training data set not only impairs ... both data sets (i.e., training, and checking data sets) Eventually, it reaches a value less than 0.5 after 200 epochs The correlated function, namely, Y = F(X), using the ANFIS approach is also...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot
... surface gradients and the albedo and also perform blind image restoration The surface gradients and the albedo are modeled as separate Markov random fields (MRFs), and a suitable regularization ... depth maps for Jodu image obtained from blurred Jodu images using LS approach and that obtained using our graph cuts-based approach One can observe that the discontinuities are better preserved in ... Hyderabad, India, January 2006 Y Boykov and V Kolmogorov, “An experimental comparison of min-cut/max-flow algorithms for energy minimization in vision,” IEEE Transactions on Pattern Analysis and Machine...
Ngày tải lên: 21/06/2014, 22:20
A Balanced Scorecard Approach for Strategy- and Quality-driven pptx
... Organization; and (9) Using Scorecard Information to Evaluate and Improve Performance To computerize data means dealing with several issues such as data quality, validation, and ownership Cascading ... pedagogical training activities to lecturers 4.2 Effective and efficient management of administrative processes Adequate infrastructures Adequate monitoring and evaluation 3.1 Infrastructures and ... plan, and react In spite of the large volume of data gathered from transactional databases (operational systems) and the existing information analysis techniques, the difficulty of generating...
Ngày tải lên: 07/08/2014, 02:20
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... genomic research Galaxy tags are hierarchical and can have values, and these features make tags amenable to many different metadata vocabularies and navigational techniques For instance, the tag encode.cell_line ... analyses and sharing Galaxy enables reuse of datasets, tools, histories, and workflows in many ways Automatic and user metadata make it simple for Galaxy users to find and reuse their own analysis ... provide an environment for recording and repeating computational analyses by automatically tracking the provenance of data and tool usage and enabling users to selectively run (and rerun) particular...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study" ppsx
... in ambulatory migraineurs Headache 2000, 40(6):457-63 29 Munakata M, Imai Y, Minami N, Sasaki S, Ichijyo T, Yoshizawa M, Sekino H, Abe K, Yoshinaga K: Cosinor analysis of changes in circadian ... not make a good match: For Poisson random variable the mean equals the variance and we assume a oscillating number of crimes So the residuals will not automatically be homoscedastic and are afterwards ... oscillating data is described Using harmonic frequencies the data are modeled as a sum of sine and cosine oscillations and a Fourier transform is performed In our case the Fourier transform equals...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
... gradients What keeps all these pathways from executing is inhibition; a series of information processing brakes that are maintained in place An analogy that comes to mind is the management of a ... this article as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA ... that tells the hardware how to implement computation and process information Information in the form of software abstraction also includes the organization of that information, as opposed to a...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A Protein Similarity Approach For Detecting Prophage Regions In Bacterial Genomes" potx
... they are cryptic or in the state of mutational decay Prophages account for a substantial amount of interstrain genetic variability in several bacterial species, for example Staphylococcus aureus ... A Protein Similarity Approach For Detecting Prophage Regions In Bacterial Genomes Geeta V Rao, Preeti Mehta, Srividhya KV and Krishnaswamy S1§ Bioinformatics Center, School ... Systems J Bacteriol 1994, 176: 5888-5896 27.Enomoto M Oosawa K and Momata H : Mapping of the pin locus coding for a site-specific recombinase that causes flagellar-phase variation in Escherichia coli...
Ngày tải lên: 14/08/2014, 14:22
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
Ngày tải lên: 13/11/2014, 10:46
A systematic approach for preferential crystallization thermodynamics, kinetics, optimal operation and in situ monitoring
... theory and indicates the characteristic of two enantiomers forming separate crystals for a racemic conglomerate The solubility characterization and ternary phase diagram of racemic compound propranolol ... controlling the supersaturation in batch crystallization (Mullin and Nyvlt, 1971; Jones and Mullin 1974; Rousseau, 1987; Rohani and Bourne, 1990) These advantages include larger crystals and narrower ... two forms can be mirror images, enantiomers occur always in pairs The importance of separating a racemic mixture (a mixture containing an equal amount of a pair of enantiomers) has been emphasised...
Ngày tải lên: 14/09/2015, 18:18
A new solution approach for the inventory routing problem using vehicle routing problem constructive heuristic
... deterministic and dynamic demand, and have a finite capacity for holding local inventory Holding costs are however considered at the central warehouse, as well as at the different retailers The authors ... builds an actual delivery schedule for the next two days, using more accurate demand information, and taking into account the proper timing of this demand The computational results were interesting, ... computed by finding a feasible solution to the dual of a set-partitioning VRP formulation Branch -and- cut is another less investigated exact solution method In this approach, the linear relaxation of...
Ngày tải lên: 16/09/2015, 15:43
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... like to introduce some features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author ... 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class of words...
Ngày tải lên: 10/04/2013, 14:46
a decentralized approach for implementing identity management in cloud computing
... Emerging Security Information, Systems and Technologies, Cap Esterel 2008 [6] R H Khan and J Ylitalot and A S Ahmed, “OpenID Authentication As A Service in OpenStack,” Information Assurance and ... [4] P Angin, B Bhargava, R Ranchal, N Singh, L B Othmane, L Lilien, and M Linderman, “An Entity-Centric Approach for Privacy and Identity Management in Cloud Computing,” Proc 29th IEEE Intl Symp ... heterogeneous and federated scenarios It’s somewhat similar to [9] The main thought is adopting the “IdM/SP model” allows to solve the SSO authentication problem using a global approach and integrating many...
Ngày tải lên: 31/07/2013, 09:43