A novel membrane pool of protein kinase c and its role in mammalian cell signaling

A novel membrane pool of protein kinase c and its role in mammalian cell signaling

A novel membrane pool of protein kinase c and its role in mammalian cell signaling

... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... discovered kinases that catalyze the phosphorylation of hydroxyamino acids All of the known protein kinases including tyrosine kinases share a related catalytic domain of about...
Ngày tải lên : 12/09/2015, 21:10
  • 221
  • 308
  • 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...
Ngày tải lên : 23/03/2014, 17:21
  • 9
  • 549
  • 0
MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS

MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS

... v ABSTRACT Liyun Cao MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS Ovarian cancer (OC) is a lethal disease due to metastasis and chemoresistance Our ... activating NF-κB complex, which leads to increased cell invasiveness in vitro and tumor metastasis in vivo The N-terminal fibronectin (FN) binding domain o...
Ngày tải lên : 24/08/2014, 10:58
  • 209
  • 383
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... well as NO production Accordingly, we concluded that the enhancing effect of TS on LPS/IFN -induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives ... amphiphilic structure of the polar carboxyl moiety and the hydrophobic isoprene moiety The enhancing effect of TS on LPS/IFN -induced NO production was inh...
Ngày tải lên : 22/02/2014, 04:20
  • 6
  • 494
  • 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...
Ngày tải lên : 14/02/2014, 19:20
  • 11
  • 658
  • 0
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx

Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx

... calcium-activated K+ channel, large-conductance Ca2+and voltage-regulated K+ channel, hyperpolarizationactivated cyclic nucleotide gated channel, ether-a-go-go and cyclic nucleotide-gated channel ... sites at the cytosolic face of KAT1 (B) Changes in the current amplitudes of the different KAT1 mutants after PMA application The characteristics of WT KAT1 in the...
Ngày tải lên : 22/03/2014, 21:21
  • 11
  • 531
  • 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx

... Gasparini, L., Binetti, G., Trabucchi, M., Bianchetti, A & Racchi, M (1998) Speci c role for protein kinase C alpha in the constitutive and regulated secretion of amyloid precursor protein in human ... obtained with strategies involving the overexpression of the PKCe V1 region, which binds specifically to the receptor for activated C -kinase (RACK), bloc...
Ngày tải lên : 23/03/2014, 13:20
  • 8
  • 458
  • 0
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt

báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt

... Immunohistochemical staining of PKCε in tissue specimens PKCε is overexpressed in both cytoplasm and nuclei of clear cell renal cell carcinoma (RCC) cells (A) Primary antibody isotype control (B) and ... radical nephrectomy or partial resection Of the 128 RCC samples, 10 were papillary RCC, 10 were chromophobe RCC, and 108 were clear cell RCC according to the 2002...
Ngày tải lên : 10/08/2014, 10:21
  • 9
  • 308
  • 0
Role of the c terminus of protein kinase c related kinase in cell signalling

Role of the c terminus of protein kinase c related kinase in cell signalling

... cAMP cDNA CDK CL CO COS cPKC C1 Degree Celcius Calmodulin Calmodulin Kinase Adenosine 3’, 5’- cyclic monophosphate complimentary deoxyribonucleic acid Cyclin-dependent kinases Cardiolipin carbon ... Protein Kinase A, Protein Kinase G and Protein Kinase C aPKC Atyptical Protein Kinase C Arg Arginine ATP Adenosine 5’ Triphosphate β bp BSA Beta Base Pair Bovine Serum Album...
Ngày tải lên : 14/09/2015, 12:01
  • 240
  • 209
  • 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...
Ngày tải lên : 18/02/2014, 18:20
  • 12
  • 613
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên : 07/03/2014, 21:20
  • 12
  • 561
  • 0
báo cáo khoa học: " Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses" ppt

báo cáo khoa học: " Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses" ppt

... et al.: Transcriptional profiling of Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that plays an important role in abiotic stress responses BMC Plant ... 5’-TAC CAT GGA CAT GTT TAC TAT GAA TCA ATT-3’ (Nco I site underlined) and 5’-ATA CTA GTT TAA AAT GAG TAA CTC CAC A- 3’ (Spe I site underlined) An Nco...
Ngày tải lên : 11/08/2014, 11:21
  • 19
  • 590
  • 0
A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway

A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway

... 5’-GAG AAG AAG GAT CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 ... The interaction of TGN subdomain and motor is selective It can be a direct binding of a cargo protein with a motor protein dynein (Tai et al., 1999); or mediated via ada...
Ngày tải lên : 11/09/2015, 09:15
  • 189
  • 302
  • 0
A BRIEF REVIEW OF CREATIVE ACCOUNTING LITERATURE AND ITS CONSEQUENCES IN PRACTICE pptx

A BRIEF REVIEW OF CREATIVE ACCOUNTING LITERATURE AND ITS CONSEQUENCES IN PRACTICE pptx

... substance representing the base of these transactions Baker and Hayes(2004) examine the creative accounting practices connected to: Off balance sheet financing Acknowledgement of profits Information ... there are numerous articles in the specific accounting literature regarding the theme of creative accounting, tackling the creative accounting techniques such as “wind...
Ngày tải lên : 29/03/2014, 14:20
  • 14
  • 693
  • 1
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

... objectives of this study were to briefly characterize the determinants of access to HAART and to assess late vs early initiation of HAART in a population-based cohort of HIV-positive Argentinean men and ... Sociodemographic and Clinical Characteristics of HIV-positive Individuals by Early or Late Start of Treatment Treatment Initiation at Baseline Variabl...
Ngày tải lên : 20/06/2014, 08:20
  • 7
  • 398
  • 0