Characterization of the role of fat10 in tumorigenesis
... for the chromatin or for the remodelling of topoisomerase on the chromosome during mitosis Depletion of the SUMO ligase Ubc9 results in the prevention of the mobilisation of Top2 and under these ... activates the transcription of target genes (Figure1.2), including cytokines, chemokines, and antiapoptotic factors (Ghosh and Karin, 2002) The critical role of NF-...
Ngày tải lên: 12/09/2015, 09:59
... change in the redox state of the stigmatellin In conclusion, the redox-induced FTIR difference spectra of the site- directed mutations in the Qo binding site of the bc1 complex from P denitrificans, ... within the Infrared spectroscopic characterization of mutations in the Qo site binding site This observation is not surprising in...
Ngày tải lên: 23/03/2014, 10:20
... BZLF1- Zp variants and EBV infection in the China children population Results Definition of type or/and type EBV in patients with EBV infection The frequency of type or type EBV infection was determined ... between these EBV genotypes and clinical phenotypes of EBV- associated diseases in Chinese children In this study, EBV DNA from blood samples of 206...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: Systematic characterization of mutations in yeast acetohydroxyacid synthase doc
... case of CS Since this side chain of CE makes important interactions with the protein, it is possible that the binding mode of other sulfonylureas differs from that of CE ể FEBS 2003 AHAS mutations ... preliminary docking calculations have shown that an inverted position is possible with the S-ring, rather than the N-ring, inserted into the substrate access channel Determining the s...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo lâm nghiệp: "Production and characterization of exocellular in ectomycorrhizal fungi proteases" pps
... nutrition of ectomycorrhizal plants I Utilization of peptides and proteins by ectomycorrhizal fungi New Phytol 103, 481-493 Abuzinadah R.,A., Finlay R.D & Read D.J (1986) The role of proteins in the ... activity was also induced in beech-Lactarius ectomycorrhizas incubated in the presence of litter proteins Gelatin was less efficient and ammonium repressed the excretio...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx
... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot
... analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa Clin Exp Immunol 2001, 124(1):69-76 35 Livraghi A, Randell SH: Cystic fibrosis and other respiratory diseases of impaired ... largely sophisticated and quantifiable, and the search for novel biomarkers of CF airways disease in this biofluid is under way [16,47] The finding of MPs in sputum...
Ngày tải lên: 12/08/2014, 11:22
Development of microextraction based techniques for quantification and behaviour characterization of nanoparticles in aquatic environments
... DEVELOPMENT OF MICROEXTRACTION- BASED TECHNIQUES FOR QUANTIFICATION AND BEHAVIOR CHARACTERIZATION OF NANOPARTICLES IN AQUATIC ENVIRONMENTS SEYED MOHAMMAD MAJEDI (M.Sc., AMIRKABIR UNIVERSITY OF ... applications of CuO on the basis of the number of papers published in the Institute for Scientific Information (ISI) Web of Science, as reported in Table 1...
Ngày tải lên: 09/09/2015, 08:18
Báo cáo y học: "Clinical review: What is the role for autopsy in the ICU" doc
... [9] Training physicians how to recommend autopsies may increase autopsy rates Reluctance of pathologists Another reason for the decline in autopsy rates is the growing reluctance of pathologists ... pathologists and clinicians The reasons for this are many First, pathologists are experiencing an increasing workload Secondly, since infectious diseases are rising, pathologists...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: "The role for autopsy in the intensive care unit: technological consideration" pptx
Ngày tải lên: 13/08/2014, 20:22
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt
... additional N -domain, homologous to the N-domains of ClpA or ClpB, and a linker domain homologous to, but half the size of, the linker domain of ClpB [19] The N-terminal region contains two 32-amino acid ... tuberculosis ClpC1 has an inherent ATPase activity and also functions like a chaperone in vitro Furthermore, we investigated the role of the N-termin...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx
... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the ... 2008 The Authors Journal compilation ª 2008 FEBS ´ C Vazquez-Martin et al Cisplatin-induced DNA damage response Cisplatin DNA damage DNA damage H2AX- P ( H2AX)...
Ngày tải lên: 30/03/2014, 04:20
Characterization of the novel role of parkin in gliomagenesis
... Function of Parkin 1.10.4 Mutations in Parkin Parkin and Cancer Cyclin E – A link between parkin, cancer and neurodegeneration? Other PD-linked Genes and Cancer A role for parkin in gliomagenesis ... that parkin also plays a role in the progression and development of a variety of cancer In this thesis, I investigated the potential role of parkin in gl...
Ngày tải lên: 10/09/2015, 08:25