Characterization of rab22b, an astroglia enriched rab GTPase, and its role in golgi and post golgi membrane traffic

... CHARACTERIZATION OF RAB2 2B, AN ASTROGLIAENRICHED RAB GTPASE, AND ITS ROLE IN GOLGI AND POST -GOLGI MEMBRANE TRAFFIC NG, EE LING B APP SC (HONS) (QUEENSLAND UNIVERSITY OF TECHNOLOGY) ... 1.1 An overview of Rab GTPases and membrane trafficking The enormous flux of membrane traffic within a cell at any point of its existence necessitates stri...

Ngày tải lên: 12/09/2015, 09:55

... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the ot...

Ngày tải lên: 07/03/2014, 21:20

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...

Ngày tải lên: 08/03/2014, 22:20

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...

Ngày tải lên: 19/02/2014, 07:20

... describes the relationship between the heme core description and the spectroscopic and redox properties of each identified heme from the NrfHA complex Conclusions D desulfuricans ATCC 27774 ccNiR ... this communication, we report for the first time the isolation and biochemical characterization of D desulfuricans ATCC 27774 ccNiR subunits The st...

Ngày tải lên: 21/02/2014, 00:20

... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge...

Ngày tải lên: 07/03/2014, 12:20

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

... N-Terminal sequencing of the kininogens was only successful from the 42-kDa band of wolffish kininogen (XLVQPGVLI…, Table 1) The major bands of both kininogens and also the 60-kDa band of cod kininogen ... biantennary and triantennary N-glycans, with extensive sialic acid O-acetylation Also O-glycosidic glycans were recovered from wolffish kininogen The permethylated O...

Ngày tải lên: 08/03/2014, 23:20

... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the veno...

Ngày tải lên: 16/03/2014, 22:20

... abrogating peanut agglutinin binding Furthermore, the peanut agglutinin staining in the developing nervous system documented by D’Amico and Jacobs [8] could not be confirmed in our in situ hybridization ... suggesting that some of these inactive proteins may act like cosmc as chaperones for core-1 b3GalT However, the combined coexpression of active and inactive D melanogaster co...

Ngày tải lên: 23/03/2014, 15:20

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins,...

Ngày tải lên: 23/03/2014, 17:21

... the 3' NTR, we have established a new method for the generation of live flaviviruses bearing whole gene insertions between the E and NS1 protein genes Although conceptually similar to the methodology ... gene between E and NS1 We have characterized foreign gene expression and genetic stability as well as recombinant virus immunogenicity Results Design Of The Stra...

Ngày tải lên: 18/06/2014, 18:20

... the 3' NTR, we have established a new method for the generation of live flaviviruses bearing whole gene insertions between the E and NS1 protein genes Although conceptually similar to the methodology ... gene between E and NS1 We have characterized foreign gene expression and genetic stability as well as recombinant virus immunogenicity Results Design Of The Stra...

Ngày tải lên: 20/06/2014, 01:20

... able to identify cytotoxic responses to several HSV antigens[ 14,15]; however, in humans there has been no correlate of the specificity of immune responses with the control of the disease Of the ... identification of the type and specificity of the T-cell responses that hold particular importance for control of the disease A full understanding o...

Ngày tải lên: 20/06/2014, 01:20

... maximum 3.3 Application of fungal protease in fish sauce processing In fish sauce fermentation, proteolysis is carried out by enzyme sources: protease in the digestion systems of fish and the protease ... the protease activity Figures and show the influence of some popular ions in food processing to the relative activity of protease from A oryzae...

Ngày tải lên: 22/07/2014, 10:21