Characterization of NPAS1, a transcription factor that regulates tyrosine hydroxylase expression during dopaminergic neuron development

... CHARACTERIZATION OF NPAS1, A TRANSCRIPTION FACTOR THAT REGULATES TYROSINE HYDROXYLASE EXPRESSION DURING DOPAMINERGIC NEURON DEVELOPMENT TEH HUI LENG CHRISTINA (B.Sc(Hons), NUS) A THESIS ... cleavage generating an amino-terminal cleavage product of approximately 20 kDa that has been implicated in mediating signaling activities in Drosophila (Lee et al, 1994;...

Ngày tải lên: 12/09/2015, 09:55

... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTA...

Ngày tải lên: 30/03/2014, 08:20

... / transcription factor ANAC019 (Arabidopsis NAC domain containing protein 19); transcription factor ANAC012/NST3/SND1 (ARABIDOPSIS NAC DOMAIN CONTAINING PROTEIN 12); transcription factor Zinc ... SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre c...

Ngày tải lên: 11/08/2014, 11:21

... of the AP-2e promoter Sox9 binding to both binding sites (Sox9_ 1 and Sox9_ 2) within the AP-2e promoter was observed in vivo (Fig 5C) Finally, the direct binding of Sox9 to the two Sox9binding ... AP-2e promoter (Sox9_ 1 and Sox9_ 2) Incubation of in vitro-synthesized Sox9 with the labeled oligonucleotides containing the Sox9- binding sites resulted in a stro...

Ngày tải lên: 18/02/2014, 08:20

... tolerance to salinity and oxidative stress in Arabidopsis [49,50] Also a rice homologue of this gene was differentially regulated by both ABA and salinity and was implicated in vesicular traffic ... transcripts that displayed a general trend of increased expression for all salt treatments were three kinases These included two receptor protein kinases (At4g04540 an...

Ngày tải lên: 12/08/2014, 05:20

... box) Recognition of proteins containing CP2- binding motifs and verification of the CP2- binding ability of REST and YY1 that contain the HXPR motif As stated above, none of the 12-mer peptide sequences ... 306–396) of the SPXX region on CP2 is involved in the binding of the ASR motif as well as HXPR (Fig 3) However, we not know whether these two motifs...

Ngày tải lên: 16/03/2014, 18:20

... El Ayeb, M., Rochat, H., Allen, P.D., Pessah, I.N., De Waard, M & Sabatier, J.M (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine ... synthesis and characterization of Pi1, a scorpion toxin from Pandinus imperator active on K+ channels Eur J Biochem 267, 5149–5155 Lebrun, B.,...

Ngày tải lên: 17/03/2014, 10:20

... primer, 5¢-CAAAACCGAACAAA AGCGAAACGCCA-3¢, 5¢ primer, 5¢-CAACCCATCCAA ATCCAGACAAAAT-3¢ All constructs were confirmed by sequencing The p21 (Waf1 ⁄ Cip1) promoter luciferase construct has been described ... Matsuzaka T, Nakagawa Y, Yamamoto T, Sato R, Takahashi A, Sone H, Yahagi N et al (2005) Lipid synthetic transcription factor SREBP- 1a activates p21WAF1 ⁄ CIP1, a universal cyclin...

Ngày tải lên: 23/03/2014, 07:20

... preparations of purified wheat and Arabidopsis thaliana eIF3 [33] Its identification as eIF3k was based on the similarity of its sequence with that of the eIF3k protein described here; no other characterization ... Immunochemical characterization of mammalian protein synthesis initiation factors Biochemistry 21, 4206–4212 Characterization of eIF3k (Eur J Biochem 270)...

Ngày tải lên: 23/03/2014, 21:20

... article as: Hichri et al.: A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity BMC Plant ... the conformational stability of the R2 domain [36] For instance, an amino acid substitution (V103L) within this Page of 14 cavity reduc...

Ngày tải lên: 11/08/2014, 11:21

... primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCATGGCATGCATAAGAGTC and GATGACGGAGATGATG for fragment 2, TCTCCGTCATCGAAC and GCAGAGTTTCTGGGT for fragment 3, AAACCATGGAATACCCAGAAACT ... Transactivation of the 2CPA promoter by Rap2. 4a (A) Activation of the 2CPA promoter by Rap2. 4a Transactivation of the 2CPA promoter by Rap2. 4a (A) Activatio...

Ngày tải lên: 12/08/2014, 05:20

... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm of ... 2000;165(2):1153-9 52 Ohminami H, Yasukawa M, Kaneko S, Yakushijin Y, Abe Y, Kasahara Y, et al Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4(+) Tcell clon...

Ngày tải lên: 12/09/2015, 09:59

... distribution-distance-derived target prediction based on a seed set of known target genes of a specific transcription factor The target prediction is based on a combination of 3184 5000 10 000 Position ... identification of transcription factor targets is robust and efficient, and systematically identifies new target genes for any given transcription factor We pr...

Ngày tải lên: 18/02/2014, 18:20

... compares the studied network with randomized versions of it with the same size and degree distribution The so-called Z-score quantifies the difference between the studied network and an ensemble of randomized ... functions, and topological features retain functionality and phylogeny However, the nature of the connections between these factors needs to be underst...

Ngày tải lên: 19/02/2014, 07:20

... concentrations on GlnK binding to TnrA GlnK TnrA interaction in the presence of mm ATP On the other hand, 2-oxoglutarate did not in uence the GlnK TnrA interaction, either alone, in the absence of divalent ... interaction of truncated TnrA proteins with GlnK and GS (A) BIAcore analysis of GlnK and GS binding to wild-type TnrA (TnrAwt), TnrA6 ,...

Ngày tải lên: 06/03/2014, 00:21