... EcoRI AAA GAATTCTTACAGGTGAGGTCAGAAGCTGATT hTF6 AAA GGATCCAATTTTGCTGTAGCAGTGGTGAA BamHI ⁄ EcoRI AAA GAATTCTTAACCTGAAAGCGCCTGTGTAG hTF7 AAA GGATCCCCCAACAACAAAGAGGGATACT BamHI ⁄ EcoRI AAA GAATTCTTAGGTGCTGCTGTTGACGTAATAT hTF8 ... EcoRI hTF5C c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA BamHI ⁄ EcoRI hTF5D c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT BamHI ⁄ EcoRI hTF5E c AAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRI hTF5F c AAAGAATTCTTAAACACTCCACTCATCACA ... EcoRI AAA GAATTCTTAGGTGCTGCTGTTGACGTAATAT hTF8 AAA GGATCCAAGGAAGCTTGCGTCCACAAGATA BamHI ⁄ EcoRI AAA GAATTCTTAGGCAGCCCTACCTCTGAGATTTT hTF 5A c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI ⁄ EcoRI hTF5B c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT BamHI...
Ngày tải lên: 30/03/2014, 11:20
... a clock means that, in many circumstances, signals are required to be valid all the time, that every signal transition has a meaning and, consequently, that hazards and races must be avoided. Intuitively ... in a substantial improvement in one or more of the above areas. Other obstacles are a lack of CAD tools and strategies and a lack of tools for testing and test vector generation. Research in asynchronous ... circuits designed and fabricated today are “synchronous”. In essence, they are based on two fundamental assumptions that greatly simplify their design: (1) all signals are binary, and (2) all components...
Ngày tải lên: 09/12/2013, 21:15
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... demonstrated that Asp129 of NirF could not be essential for any function similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative ... understood. Anal- ysis of insertional mutagenesis and complementation work in Pseudomonas aeruginosa, Pseudomonas fluores- cens, Paracoccus denitrificans and Pseudomonas stutzeri have shown that a set of ... sequences, notably for two strains of Ps. aeruginosa, PA7 and PAO1, but also that in Magnetospirillum magneticum, do not have any readily recognizable, i.e. N-terminal positive charges, central hydrophobic...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... because of the absence of the catalytic subunit ISP (Table 1). Figure 3A shows that a band of approximately 500 kDa was also found in this mutant strain when the mitochondrial membranes were ana- lyzed ... c oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14]. A higher-order organization of the respiratory chain ... specific chaperone proteins is also required. The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc 1 intermediate [28,29] and that Cbp3p and...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx
... and 127 of the Neurospora crassa chorismate synthase with alanine, producing two single-mutant proteins (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16Ala- Ser127Ala). The residual ... Ser127Ala and Ser16AlaSer127Ala mutant proteins, respectively. These results demon- strated that none of the amino acid replacements significantly affected the utilization of NADPH as a source of ... alignments of chorismate synthas- es from bacterial, fungal, plant and protozoan origin, of the crystal structure of the enzyme with bound EPSP and of the flavin cofactor, revealed two invariant serine...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3Â,andtheEcoRI restriction fragment of the chloroplast genome R14 [16] as a template. The resulting DNA fragment was then digested by ClaIandNcoI (two restriction ... 594–604. 42. Hagio, M., Sakurai, I., Sato, S., Kato, T., Tabata, S. & Wada, H. (2002) Phosphatidylglycerol is essential for the development of thylakoid membranes in Arabidopsis thaliana. Plant Cell ... by capillary gas-liquid chromatography using a 50 m long, 0.25 mm diameter CP-wax 52 column. Heptanoic acid was used as an internal standard. Results The absence of functional PSII and lack of...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Hepatocyte growth factor activator (HGFA): a serine protease that links tissue injury to activation of hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... Shimomura T, Miyazawa K, Komiyama Y, Hiraoka H, Naka D, Morimoto Y & Kitamura N (1995) Activation of hepatocyte growth factor by two homologous proteases, blood-coagulation factor XIIa and hepatocyte ... S & Daikuhara Y (1988) Purification and partial charac- terization of hepatocyte growth factor from plasma of a patient with fulminant hepatic failure. J Clin Invest 81, 414–419. 4 Miyazawa...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... Masayo Hosono 1, *, Miyako Kitamura 1 , Tatsuya Tsuda 2 , Kiyofumi Yamanishi 2 , Masatoshi Maki 1 and Kiyotaka Hitomi 1 1 Department of Applied Molecular Biosciences, Graduate School of Bioagricultural ... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Relative value 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Fig. 4. Assessment of the contribution of each amino acid residue of K5 to substrate recognition. Alanine ... Bioagricultural Sciences, Nagoya University, Japan 2 Department of Dermatology, Hyogo College of Medicine, Nishinomiya, Japan Transglutaminase (TGase; EC 2.3.2.13) is a Ca 2+ - dependent enzyme that catalyzes...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: A sucrose binding protein homologue from soybean exhibits GTP-binding activity that functions independently of sucrose transport activity pptx
... the characterization of a member of the SBP family from soybean [Glycine max (L) Merrill] designated S64 or SBP2. Subcellular fractionation and pre- cipitation by GTP-agarose demonstrated that S64/SBP2 ... Enhanced accumulation of SBP caused an increase in intracellular sucrose synthase activity with a concomitant decline in cell-wall invertase activity. This alteration in sucrose-cleaving activities ... the identification of an isoform of soybean SBP, designated S64 or SBP2, and we show that the SBP homologue is a membrane-associated GTP binding protein. We have generated mutants that blocked...
Ngày tải lên: 23/03/2014, 21:21
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... Escherichia; Hafnia alvei; diarrhea; neuraminic acid. Hafnia alvei is a Gram negative bacterium and a member of the family Enterobacteriaceae. There are reports of associ- ation of H. alvei with diarrhoea ... and it was therefore concluded that the same polysaccharide was present. A hydrolysate of the upper phase, analyzed as alditol acetates, revealed as D -glucose, D -galactose, D -galactosamine, L -glycero- D -manno-heptose, and D -glucosamine ... of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia Reine Eserstam 1 , Thushari P. Rajaguru 1,2 , Per-Erik Jansson 1 , Andrej...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversification of b-toxins ppt
... quinquestriatus hebraeus was collected from scorpion stings to a parafilm membrane. Sarcophaga falculata (blowfly) larvae and Periplaneta americana (cock- roaches) were bred in the laboratory. Albino laboratory ICR ... binding to rat brain synaptosomes [23]. As AahIT4 shares little sequence similarity with any of the known anti-mammalian scorpion toxins [1,12], and no information was available on its mode of action, ... various insect and mammalian sodium channels [1,2,21,22]. As b-toxins that affect mammalian sodium channels have not been identified in the ÔOld WorldÕ, it was assumed that diversification of anti-mammalian b-toxins...
Ngày tải lên: 31/03/2014, 01:20
High speed digital system design a handbook of interconnect theory and design practices john wiley
... proportional to the rate of change, mutual inductance becomes very significant in high-speed digital applications. Mutual capacitance is the other mechanism that causes crosstalk. Mutual capacitance ... times larger than the series resistance of the conductor. 3.1. MUTUAL INDUCTANCE AND MUTUAL CAPACITANCE Mutual inductance is one of the two mechanisms that cause crosstalk. Mutual inductance ... vector network analyzer (VNA). In the frequency domain, the ac resistance is often characterized by the attenuation factor, α, which is a measure of signal amplitude loss as a function of frequency...
Ngày tải lên: 05/04/2014, 23:04
urban design - a typology of procedures and products
... cemetery of San Cataldo, Modena, Italy 135 C ASE STUDY: Kresge College, University of California at Santa Cruz, California, USA 138 C ASE STUDY: Ghirardelli Square, San Francisco, USA 140 Urban objects ... primary dimension of any categorization. A further distinction can be made amongst urban design projects based on the vocabulary of patterns that forms the basis of their design. The vocabulary, ... in Ahmedabad. The individuals who have assisted me include El-Hassan Amr, Oleksandra Babych, Clare Billingham, Kevin Brake, Giancarlo Cerutti di Ludovico, Nick Chapin, Carol Chan, Tao Cheehai,...
Ngày tải lên: 29/04/2014, 15:46
báo cáo hóa học: "Single-trial classification of NIRS signals during emotional induction tasks: towards a corporeal machine interface" pptx
... series of questions. An average offline classification accuracy of 80% was achieved in 40% of the locked-in participants using a non-linear discriminant classifier. The ultimate goal of a corporeal ... a baseline state can be detected. Using the optimal feature set for each participant, mean classifica- tion rates were calculated via 10 runs of 5-fold cross-vali- dation, over a range of analysis ... optimal classification accuracy was achieved for 8 of the 10 partic- ipants with an LDA-trained classifier, which is advanta- geous for its computational speed and ease of implementation. Quantifying...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx
... the descriptive analysis, obesity had a high hazard ratio of Table 2: Clinical and radiographic characteristics before and after UKA Variables Pre-operative [SD] Final follow-up [SD] P value a Knee Society ... was per- formed using antero-posterior, lateral, and Merchant view radiographs of the knees (Figure 1B), with measurement of femoral and tibial angles, alpha and beta angles, and medial and lateral ... lateral joint spaces as described by Villers and Cartier [7]. Patients were additionally evaluated for the presence of patellar osteophytes as an indicator of patel- lofemoral arthritis that is easily...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo khoa học: " A novel virus that infecting hypovirulent strain XG36-1 of plant fungal pathogen Sclerotinia sclerotiorum" pptx
Ngày tải lên: 12/08/2014, 04:21