Proteomics analysis of pseudomonas putida in biodegradation of aromatic compounds

... PROTEOMICS ANALYSIS OF PSEUDOMONAS PUTIDA IN BIODEGRADATION OF AROMATIC COMPOUNDS CAO BIN (B Eng., Beijing University of Aeronautics and Astronautics, China) A THESIS SUBMITTED ... understanding of the catabolic pathways and the physiological status of P putida during biodegradation of aromatic compounds A comprehensive understanding of the bacterial phys...

Ngày tải lên: 12/09/2015, 08:19

... the C-terminal domain, the E coli Pta N-terminal domain is involved in stabilization of the hexameric native structure, in expression of the maximum catalytic activity, and in allosteric regulation ... Results Expression and purification of E coli Pta and truncated Ptas containing the C-terminal end By analysis of the protein domain architecture of E coli Pta...

Ngày tải lên: 06/03/2014, 11:20

... Analysis of signaling networks using protein arrays H Voshol et al a contextual understanding of the molecular mechanisms of disease, but also has the potential to facilitate the validation of ... possible Arguably, signaling pathways are currently the best practical translation of ‘physiology’ because Analysis of signaling networks using protein arrays t...

Ngày tải lên: 16/03/2014, 00:20

... methyl esters The main Lipophilic compounds in Pinus pinea L 453 Table III Fatty and resin acids, such as methyl esters, in needles of Pinus pinea (% methylated fatty and resin acid fractions, ... since their values only vary between Lipophilic compounds in Pinus pinea L 451 Table I Presence of monoterpene, sesquiterpene, neutral diterpene, fatty acids and resi...

Ngày tải lên: 09/08/2014, 04:20

... global protein profilings of normal human bronchial epithelial cells (NHBE) and normal human lung fibroblasts (NHLF) stimulated with pro- inflammatory cytokines tumor necrosis factor (TNF)-α and/ or ... contribution of two major airway resident cells, bronchial epithelial cells and lung fibroblasts, to the inflammatory events will be reviewed and disc...

Ngày tải lên: 11/09/2015, 16:05

... the pyranopterin part of the cofactor is somehow defective in Qor from strain KT2440 pUF1 UV/Visual spectra of the Qor proteins from P putida 86, P putida KT2440 pUF1 and P putida 86-1 Dqor pUF1 ... putida 86-1 Dqor pUF1 is not able to grow on quinoline as a sole source of carbon Kinetic properties of the Qor proteins from P putida...

Ngày tải lên: 17/03/2014, 10:20

... showing significant higher in vivo concentrations in most strains of P aeruginosa [18] This biomarker could then be used in the detection of P aeruginosa in breath, whether or not in combination ... doi:10.1186/1465-9921-13-87 Cite this article as: Goeminne et al.: Detection of Pseudomonas aeruginosa in sputum headspace through volatile organic compoun...

Ngày tải lên: 05/03/2014, 21:20

... 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - primer ... (CATGCCATGGGTGCTGTAGT TACAGTAAGGAAC) and primer (CCGCTCG AGTATCGATACACTATTTGGAAC) - primer (CA TGCCATGGGTCACCACCACCACCACATGGCACT TGCTAAAGAAATTATG) and primer (CCGCTCGAG P...

Ngày tải lên: 11/08/2014, 11:21

... cytoskeleton system proteins, which have the maximum profusion among the identified cellular proteins, including Actin, Keratin, Annexin, Coronin, Tubulin, Tropomyosin, and Cofilin Enveloped viruses ... Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis Virology Journal 2010 7:242 Submit your nex...

Ngày tải lên: 12/08/2014, 01:22

... factors Several classes of transcription factors have been implicated in plant defense responses, including DNA-binding proteins containing the novel WRKY zinc-finger motif [6] Although originally ... underlined C EMSA to test binding of recombinant WRKY25 to the W box motif in the Pchn5 probe Binding reactions containing WRKY25 and Pchn5 produced two major DNA/protein compl...

Ngày tải lên: 12/08/2014, 05:20

... ! ! MULTI& STRATEGIES, FOR, CONTROL, OF, MOTILITY, VIA, MORA, SIGNALING, PATHWAY, IN, PSEUDOMONAS, PUTIDA, , , , , , , , , NG WEI LING (B Sc.(Hons), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... messenger signaling Genomic and signaling studies on new models led to the finding that signaling proteins are typically modular in nature with each con...

Ngày tải lên: 09/09/2015, 17:53

... pressure, and heart rate Conclusions Velocity Vector imaging (VVI) is a clinically feasible approach for strain measurements in infarcted myocardium allowing an accurate assessment of global and regional ... Duan Y, Yuan L, Yang Y Velocity vector imaging in assessing the regional systolic function of patients with post myocardial infarction Echocardiograph...

Ngày tải lên: 25/10/2012, 11:15

... molecules in the course of hypoxia-induced apoptotic pathways Such analysis of trophoblastic cells will, in the near future, yield insights into the mechanisms of preeclampsia and other hypoxia-related ... and by modulating phosphorylation of JNK In conclusion, various pro- and antiapoptosis-related proteins were expressed in the process of hypoxia-induced apoptos...

Ngày tải lên: 31/10/2012, 15:12

... ethanol- regulated genes were involved using KEGG (Kyoto Encyclopedia of Genes and Genomes) [36] and GenMAPP (Gene Microarray Pathway Profiler) [37] analysis As shown in Table 2, only ITGB4 was found to be involved ... considering the reported high expression of the ankyrin-repeat oncoprotein (gankyrin) in human hepatocellular carcinoma Gankyrin binds to the cell-...

Ngày tải lên: 31/10/2012, 15:28

... healthy individuals Interestingly, this SNP had not yet been registered in any SNP databases despite of its high frequency of 20% in samples of patients with AML and 13,7% in healthy individuals After ... Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line Nature 2001;413(6853):316-22 Yada M, Hatakeyama S, Kamura T, Nishiy...

Ngày tải lên: 31/10/2012, 16:49