Possible role of diva in microglial dual effects and the stem cell differentiation

Possible role of diva in microglial dual effects and the stem cell differentiation

Possible role of diva in microglial dual effects and the stem cell differentiation

... cells in the cell cycle and promote cell proliferation However, the function of Diva in the regulation of cell cycle has never been investigated In the present study, the effects of Diva on the ... microglia dual effects, investigate the distribution of Diva in central nervous system and study the possible involvement of Diva in th...

Ngày tải lên: 12/09/2015, 08:19

185 260 0
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx

Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx

... cells and incubated with a circular plasmid as the substrate DNA The substrate plasmid DNA was 5381 Mitochondria in nuclear death of Tetrahymena T Kobayashi and H Endoh B A C Fig Mitochondrial nuclease ... phosphatase activity was higher in fractions and than in fraction (Table 1) These results indicate that fraction contains a significant number of mitoc...

Ngày tải lên: 20/02/2014, 03:20

10 643 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGA...

Ngày tải lên: 12/08/2014, 16:20

12 355 0
The role of precautionary labelling for food allergens and the care of children with food allergies

The role of precautionary labelling for food allergens and the care of children with food allergies

... labelling in the care of children with food allergies The thesis focuses on two key areas of research The first explores current practices with regard to precautionary labelling and the impact of these ... of the allergic patient 16 General Declaration I, Giovanni Zurzolo, declare that the PhD thesis entitled ‘ The Role of Precautionary Labellin...

Ngày tải lên: 04/12/2015, 13:59

135 394 0
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx

... (preproinsulin) and folded as proinsulin, in which a connecting peptide of 35 residues links the C terminus of the B chain and N terminus of the A chain After digestion by a specific set of protein ... enzymes in the B-cell granule, proinsulin is converted into insulin and C-peptide of 31 amino acids [26] Previous studies completed on the unfolding process of insul...

Ngày tải lên: 19/02/2014, 12:20

11 528 0
Báo cáo khoa học: Dual role of Nbs1 in the ataxia telangiectasia mutateddependent DNA damage response ppt

Báo cáo khoa học: Dual role of Nbs1 in the ataxia telangiectasia mutateddependent DNA damage response ppt

... its role in the DNA damage response In addition, the extreme COOH-terminal region (amino acids 734–754) of Nbs1 mediates the interaction of Nbs1 with ATM and the recruitment of ATM to sites of DNA ... MRN foci [19–21] The Mre11-binding domain of human Nbs1 has been localized to amino acids 682–693 in the COOHterminal region of the protein Deleti...

Ngày tải lên: 16/03/2014, 13:20

7 384 0
Báo cáo y học: "Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries" ppsx

Báo cáo y học: "Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries" ppsx

... explain the mechanisms of its neuroprotective effects and before the use of a-LA in low back pain can be instituted, as only in diabetic neuropathy and perhaps chemotherapy-induced neuropathy has ... could prevent the formation of ROS [7], while a-LA could act removing those just formed Our data suggested the importance of a-LA in the treatment of peripheral ner...

Ngày tải lên: 10/08/2014, 10:20

2 438 0
báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

báo cáo khoa học: " Efficacy of Mesenchymal Stem Cells in Suppression of Hepatocarcinorigenesis in Rats: Possible Role of Wnt Signaling" doc

... of MSCs to cancer cells, nature of tumour cells and cancer stem cells, integrity of immune system, number of stem cell passages and site of injection; all can affect the outcome of MSCs use in ... tissues by assessing the gene expression profile of some of the Wnt signaling target genes:cyclin D, PCNA, survivin, b-catenin Methods Ninety albino female rats inbred st...

Ngày tải lên: 10/08/2014, 10:21

11 338 0
Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

Báo cáo y học: " Candida soluble cell wall β-glucan facilitates ovalbumin-induced allergic airway inflammation in mice: Possible role of antigen-presenting cells" ppt

... lungs Histological findings of hematoxylin and eosin (H&E)-stained Histological findings of hematoxylin and eosin (H&E)stained lungs The groups of mice were intratracheally inoculated with vehicle, ... that a single pulmonary exposure to CSBG induces lung inflammation characterized by the infiltration of inflammatory leukocytes including eosinophils with an enhanced lung expression...

Ngày tải lên: 12/08/2014, 14:20

12 246 0
Báo cáo y học: " Dual role of TRBP in HIV replication and RNA interference: viral diversion of a cellular pathway or evasion from antiviral immunity?" potx

Báo cáo y học: " Dual role of TRBP in HIV replication and RNA interference: viral diversion of a cellular pathway or evasion from antiviral immunity?" potx

... two inhibitors of the IFN-induced protein kinase R (PKR), inhibit RNAi pathways in plants and in Drosophila cells [12] HIV- 1 Tat protein acts as an RNAi suppressor in the pathway mediated by shRNAs ... shRNAs but not siRNAs, suggesting a specificity of action [10] Adenovirus VA RNAI and VA RNAII are cleaved by Dicer and act as RNAi suppressors [13] Both Tat protein and...

Ngày tải lên: 13/08/2014, 09:21

6 242 0
ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU

ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU

... unwavering support of my goals iv ABSTRACT Sara M McNeil ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU8 0 CTERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU DNA double strand breaks ... than that of the 16 kDa Ku8 0CTR band and the band intensity generated from Ku7 0 and Ku8 0 C antibodies, indicating a small per...

Ngày tải lên: 24/08/2014, 11:02

76 440 0
 Circuit theory of finance and the role of incentives in financial sector reform

Circuit theory of finance and the role of incentives in financial sector reform

... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...

Ngày tải lên: 24/10/2012, 09:33

55 666 0
Facts of Vietnam Freight forwarding industry and the role of Vietnam Freight Forwarders Association (VIFFAS) to the industry in international economic integration processhelpful to Oristar.doc

Facts of Vietnam Freight forwarding industry and the role of Vietnam Freight Forwarders Association (VIFFAS) to the industry in international economic integration processhelpful to Oristar.doc

... about the facts of Vietnam freight forwarding industry and the Association s importance to the industry, especially in today’s economic integration process Therefore, I chose the topic Facts of Vietnam ... Association (VIFFAS) and then emphasize on the role of the Association (VIFFAS) to Vietnam freight forwarding industry...

Ngày tải lên: 27/10/2012, 16:42

31 1,2K 21
w