Antiproliferative activity of curcumin analogs on acute promyelocytic leukemia synthesis and mode of action studies
... depending on the differentiation direction and degree of maturation 1.2 Acute Promyelocytic Leukemia (APL) Acute promyelocytic leukemia (APL) accounts for 10 – 15 % of acute myeloid leukemia (AML) and ... 3.3.2 Anti-proliferative activity of curcumin and analogs on leukemic non-APL cell lines 91 3.3.3 Anti-proliferative activity of curcumin and...
Ngày tải lên: 11/09/2015, 14:20
... et al.: Inhibition of mitotic kinase Aurora suppresses Akt-1 activation and induces apoptotic cell death in all-trans retinoid acid-resistant acute promyelocytic leukemia cells Journal of Translational ... activation of Aur-A and induces monopolar spindle in NB4-R2 cells (A) VX-680 inhibited phosphorylation of AurA at Thr288 in NB4-R2 cel...
Ngày tải lên: 18/06/2014, 19:20
... et al.: Inhibition of mitotic kinase Aurora suppresses Akt-1 activation and induces apoptotic cell death in all-trans retinoid acid-resistant acute promyelocytic leukemia cells Journal of Translational ... proliferation of leukemic cells in AML and inhibition of activation of Akt can result in suppression of cell growth [40,41] In...
Ngày tải lên: 20/06/2014, 03:20
Characterisation of the effects and mechanism of action of rapamycin and genistein on acute myeloid leukemia using high throughput techniques
... of an in-depth examination of the biology of acute myeloid leukemia, the drugs rapamycin and genistein, and an evaluation of the advantages of combining high- throughput approaches and functional ... a long period of time On the one hand, the risk factors include heredity, abnormal genetic regulation and genetic makeup of some individuals On the...
Ngày tải lên: 11/09/2015, 09:18
BROAD-SEARCH ANNOTATED BIBLIOGRAPHY ON Acute Respiratory Infections (ARI) and Indoor Air Pollution pptx
... this bibliography focuses on children and environmental health conditions in developing nations This bibliography augments the 1997 Annotated Bibliography on Acute Respiratory Infections (ARI) and ... California This new annotated bibliography contains citations and abstracts for 235 papers that relate to air pollution and environmental exposure as a risk...
Ngày tải lên: 23/03/2014, 00:20
Báo cáo y học: "Downstream molecular pathways of FLT3 in the pathogenesis of acute myeloid leukemia: biology and therapeutic implications" pps
... Takahashi: Downstream molecular pathways of FLT3 in the pathogenesis of acute myeloid leukemia: biology and therapeutic implications Journal of Hematology & Oncology 2011 4:13 Submit your next manuscript ... The compounds currently in development are heterocyclic compounds containing components that structurally mimic the purine ring of adenosine and be...
Ngày tải lên: 10/08/2014, 21:23
Role of promyelocytic leukemia (PML) and small ubiquitin like modifier (SUMO) proteins in alternative lengthening of telomeres
... modifications of a protein may also involve the attachment of other proteins or peptides, such as ubiquitin and the small ubiquitin- like modifier (SUMO) Subsets of a pool of proteins may be modified ... according to the cellular conditions and microenvironment as part of the cellular response and regulatory processes 1.1.1 Small Ubiquitin- like Modifier...
Ngày tải lên: 11/09/2015, 10:18
Agents for hepatocellular carcinoma synthesis and mode of action
... bonds in 47 and guandinium side chain of Arg 97 and carbonyl O of Ser 263 Figure 4-10: H bonding between (A) sulfonyl O atoms of 3-12 and Arg 97, Ser 263 Phe 96; (B) Nitro O atoms of III and Ser ... sequences involved in synthesis of 3-formyl-N-substituted benzenesulfonamides Scheme 2-4: Reaction scheme for synthesis of 5,6-difluoro-oxindole Scheme 2-5 Syntheses of...
Ngày tải lên: 09/09/2015, 11:09
Investigations into the chemopreventive potential of stilbenes, indolinones and isoindigos synthesis and mode of action studies
... INVESTIGATIONS INTO THE CHEMOPREVENTIVE POTENTIAL OF STILBENES, INDOLINONES AND ISOINDIGOS: SYNTHESIS AND MODE OF ACTION STUDIES ZHANG WEI (B.Sc., SOOCHOW UNIVERSITY) A THESIS SUBMITTED FOR THE ... of the chemical shifts of the aromatic protons of ring B (in particular H-2' and H-6') provided a useful means of assigning the Z/E configuration o...
Ngày tải lên: 11/09/2015, 09:06
Photocatalytic bactericidal activity of silver-sensitized titanium dioxide on Micrococcus lylae
... the loss of cell viability CONCLUSION Based on the experimental results, disinfection of water by PCO is feasible The effectiveness of bactericidal action can be improved by optimization of physico-chemical ... the loss of cell viability at the early stage of PCO and the appearance of electron-translucent region after 30 of irradiation Cell wall destruction was believed to...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... IMAGEQUANT software, and depurination was calculated by relating the amounts of the small aniline-fragment and 5.8S rRNA and expressing values as a percentage Reassociation and quantification of ... carried out for each individual atom Data collection and refinement statistics are given in Table Assay of the N-glycosidase activity of ricin A chain variants The...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo Y học: The effects of ring-size analogs of the antimicrobial peptide gramicidin S on phospholipid bilayer model membranes and on the growth of Acholeplasma laidlawii B ppt
... ringsize analogs < /b> of < /b> GS (GS10, GS12 and < /b> GS14) with phospholipid < /b> bilayer < /b> model < /b> membranes < /b> We first investigated the < /b> effects < /b> of < /b> these GS ring-size < /b> analogs < /b> on < /b> the < /b> thermotropic phase behavior of < /b> LMVs composed ... that studies of < /b> the < /b> interactions of < /b> other analogs < /b> of <...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: Coordination chemistry of iron(III)±porphyrin±antibody complexes In¯uence on the peroxidase activity of the axial coordination of an imidazole on the iron atom ppt
... a monoclonal anti-porphyrin Ig, with an iron( III)-DoCPP cofactor and imidazole as an axial ligand of the iron which, respectively, mimick the heme cofactor and the axial histidine ligand of the ... Binding of imidazoles to the iron( III) of Fe(ToCPP) and Fe(ToCPP))13G10 The second part of our results concerns the binding of imidazole derivatives on...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Effect of annealing time of an ice crystal on the activity of type III antifreeze protein pdf
... III AFP onto the flat ice plane (B) Overgrowth of the convex ice front, giving a low TH value (C) Possible secondary ice binding of type III AFP onto the convex ice front during the annealing period ... lowering of the annealing temperature, and TH shows dependence on crystal size only after 2–3 h of annealing As the timedependent amplification of T...
Ngày tải lên: 07/03/2014, 05:20