Development of a novel immersed boundary lattice boltzmann method and its applications
Development of a novel immersed boundary lattice boltzmann method and its applications
... Organization of The Thesis 23 Chapter Development of Efficient Lattice Boltzmann Method on Non-Uniform 25 Cartesian Mesh 2.1 Standard LBM 26 2.2 Taylor Series Expansion and Least Squares-base Lattice ... Non -Boundary Conforming Method 1.2.1 Sharp interface approach 1.2.2 Diffuse interface approach 1.2.2.1 Immersed boundary method 1.2.2.2 Force calculation in IBM 1.2.2.3 Advantages and disadvantages ... 1.2.2.3 Advantages and disadvantages of IBM The major advantage of IBM is its simplicity and easy implementation This is attributed to the decoupling of the solution of governing equation with the boundary...
- 277
- 412
- 0
Development of a flexible forcing immersed boundary lattice boltzmann method and its applications in thermal and particulate flows
... boundary – lattice Boltzmann method 15 1.6 Applications in thermal and moving boundary problems using immersed boundary – lattice Boltzmann method 17 1.6.1 Natural convection in a complex ... Immersed boundary – thermal lattice Boltzmann method IFEM Immersed finite element method IIM Immersed interface method ISLBM Interpolation-supplemented LBM LGCA lattice gas cellular automata LBE Lattice ... thermal flow problems such that both velocity and temperature boundary conditions are accurately satisfied 1.6 Applications boundary in thermal problems and using moving immersed boundary – lattice...
- 266
- 644
- 0
THE STUDY OF a NOVEL MIXED LINEAGE LEUKEMIA 5 ISOFORM AND ITS ASSOCIATION WITH HUMAN PAPILLOMAVIRUS 16 18 RELATED HUMAN CERVICAL CANCERS
... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... HPV18_7239.rev ACAACAACAACCATACATACC HPV18_ 7168 .for TGTTGTGTTTGTATGTCCTGT HPV18_7 350 .rev CCACAAACACAAATACAGTTGTT HPV18_7378.for TATTGTCCTGTATTTCAAGTTAT HPV18_ 757 6.rev CGCGCCAATTGTTCAAAATATG 2.11 Rapid amplification ... CATCTGACATATTTTCCCGCTTCCGGCGTTGT AGTAGCAC 36 GFP- M5_Y 35 8A. for AGAGGGAAGTTTATG MLL5β‐ SET mut ATTTGCCTCCTGATGCACTTATCATTGAAGCC M5_Y 35 8A. rev CATAAACTTCCCTCTGGCTTCAATGATAAGTG CATCAGGAGGCAAAT...
- 140
- 396
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not shown) These results indicate that the ... or in the presence of EDTA, which indicated that the cross-linking reaction was catalyzed specifically by TGase To further evaluate the specificity of the assay for TGase 1, skin sections from a...
- 11
- 449
- 1
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx
... interferon-gamma in response to mitogen, superantigen and recall viral antigen Vet Immunol Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 Immunopathol 1998, ... of antibodies to rpIL-6 Optimization of the antibody titer was conducted using a check board titration of ELISA In each microplate well, Development of a novel antigen capture-ELISA using IgY against ... sensitive and specific capture-ELISA for the diagnosis of a farm’s sanitary state Materials and Methods Production of recombinant pig IL-6 Cloning of cDNA encoding mature protein: Total RNA was extracted...
- 7
- 400
- 0
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... Phage # TC-83 TrD P676 3880 Mena II 78V Fe37c BeAn8 Pixuna CaAr508 AG80 Control Figure Reactivity of phagemid clones to a wide range of VEEV strains Reactivity of phagemid clones to a wide range ... into a murine IgG 2a kappa antibody, which was designated CUF37- 2a Murine IgG 2a was chosen as the framework as it has equivalent biological and functional activities to human IgG1 The amino acid ... classical hybridoma technology ( 1A4 A-1, 3B 2A- 9 and 1A3 B-7) Humanisation of CUF37- 2a will be essential if this antibody is to find use as an antiviral in humans and these data suggest that CUF37-2a...
- 9
- 290
- 0
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf
... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Takahashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, ... corresponding to Aux/IAA genes Motif Transcription Factor Family*1 ([ACGT]GAA [ACGT]){3} TGACAGGT CCAC [AC ]A [ACGT] [AC] [ACGT] [CT] [AC] GG [ACGT]CCCAC GTGG [ACGT]CCC CAACA [ACGT]*CACCTG A [TC]G [AT ]A ... [CT]CT AATATATTT TGTCTC TGACGTGG CCA [ACGT]TG CACCC CC [AT]{6}GG AATAAA [CT]AAA CGTG [TC]G [GC] [GC] [GA]CGCC AGCCGCC CCAAT TATA [AT ]A [TA]AAAG CA [ACGT] [ACGT]TG HSF Helix-turn-helix(HTH) LIM finger...
- 10
- 397
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI- GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore ... for the development and analysis of test interface for wafer level package operation at multi- gigahertz frequencies (about 2.5 to GHz) given the tight geometrical constraints of fine pitch (of the ... mesh media, inhomogeneous media with multilayered composites and applies the models for the development of a novel test interface for wafer level packages (WLP) operating at multi- gigahertz frequencies...
- 202
- 532
- 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering distinct signaling cascades and leading ... Chapter 6.1 Discussion Development of a TLR -based two- hybrid assay for the detection of proteinprotein interactions 6.2 158 Investigation of CD14 dimerization and its role in CD14 signal transduction...
- 236
- 494
- 0
Development of a novel method in electroless copper plating
... which are generally anions, such as cynide, are added to increase the plating rate to an acceptable level without causing plating bath instability The plating rate of common electroless plating bath ... ethylenediaminetraacetic acid (EDTA), malic acid (Mal), succinic acid (Suc), tartrate (Tart), citrate (Cit), triethanolamine (TEA) and ethylenediamine (En) (Mallory and Haju, 1990), (Shacham-Diamand ... et al., 1992) Electroless plating offers many advantages over electroplating, but it is not without its drawbacks Table 1.1 shows some of the advantages and disadvantages of electroless plating...
- 140
- 275
- 0
Báo cáo y học: "Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery" docx
... article as: Kooren et al.: Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery Clinical Proteomics ... DeSouza LV, Matta A, Tripathi SC, Ghanny S, DattaGupta S, Thakar A, Chauhan SS, Siu KWM: iTRAQMultidimensional Liquid Chromatography and Tandem Mass Spectrometry-Based Identification of Potential Biomarkers ... Collectively our results demonstrate the great potential of our exudate collection method for oral cancer biomarker discovery and clinical diagnostics Methods Patient information Exudates and brush...
- 11
- 350
- 0
The effects of fungal stress on the selected plant seeds and its applications for novel food development
... and developing functional food thereof 1.2 Objectives The overall objective of this research is to study the effects of fungal stress on plant seeds and further study the stressed seeds for novel ... the changes of nutritional profiles of the fungal stressed bean seeds are also evaluated Based on the investigations, the fungal stressed bean seeds were utilized for developing a novel soy yogurt ... especially on the antioxidant capacity of black soybean seeds (Chapter 4) 3) To study the effects of fungal stress on the nutritional value of black soybean seeds and to process a novel black...
- 204
- 357
- 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel ... some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ester present react with water and can form soap Two to ... Figure shows Jatropha plant in Energy park of Rajiv Gandhi Proudyogiki Vishwavidyalaya (R.G.P.V.) Jatropha plant bears fruits from second year of its plantation and the economic yield stabilizes...
- 12
- 568
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
- 12
- 772
- 0
A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway
... 5’-GAG AAG AAG GAT CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 ... The interaction of TGN subdomain and motor is selective It can be a direct binding of a cargo protein with a motor protein dynein (Tai et al., 1999); or mediated via adaptor proteins (Nakagawa ... coenzyme A oxidase AP-1 adaptor protein- 1 ARF ADP ribosylation factor Arg arginine ARNO ARF nucleotide binding site opener BAR Bin/amphiphysin/Rvs (domain) BFA Brefeldin A BIG1/2 BFA inhibited...
- 189
- 302
- 0
Từ khóa: development of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsdevelopment of a spoken languagedevelopment of a recipe management systemthe design and development of a solar powered refrigeratorwhat is the role of mass communication in the development of a countrythe role of communication in economic development of a societythe role of transportation and communication in economic development of a countrydescribe the development of a seed from the ovule and embryo sacrole of agriculture sector in economic development of a developing countrydevelopment of a human embryo from fertilization to implantationdesign and development of a productdevelopment of a method to measure consumer emotions associated with foodscloning sequencing and expression of a novel goose type lysozyme gene with chitinase ra chic activity from the moderately thermophilic bacterium ralstonia sp a 471development of a cation exchange purification step for an fc fusion proteinthe development of a differential extraction procedureNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ