Development of a novel immersed boundary lattice boltzmann method and its applications
... Organization of The Thesis 23 Chapter Development of Efficient Lattice Boltzmann Method on Non-Uniform 25 Cartesian Mesh 2.1 Standard LBM 26 2.2 Taylor Series Expansion and Least Squares-base Lattice ... Non -Boundary Conforming Method 1.2.1 Sharp interface approach 1.2.2 Diffuse interface approach 1.2.2.1 Immersed boundary method 1.2.2.2 Force calculation in IBM 1.2....
Ngày tải lên: 11/09/2015, 09:59
... boundary – lattice Boltzmann method 15 1.6 Applications in thermal and moving boundary problems using immersed boundary – lattice Boltzmann method 17 1.6.1 Natural convection in a complex ... Immersed boundary – thermal lattice Boltzmann method IFEM Immersed finite element method IIM Immersed interface method ISLBM Interpolation-supplemented...
Ngày tải lên: 09/09/2015, 11:16
... CGCGGATCCAATGGACTACAAAGACGATGAC GACAAGAGCATAGTGATCCCA MLL5β M5b_NotI.rev AAGGAAAAAAGCGGCCGCCAATATACGCGA GACTAGTCTT GFPMLL5β M5b_SalI.for ACGCGTCGACATGAGCATAGTGATCCCATTG M5b_BamHI.rev CGCGGATCCCAATATACGCGAGACTAGTCTT ... HPV18_7239.rev ACAACAACAACCATACATACC HPV18_ 7168 .for TGTTGTGTTTGTATGTCCTGT HPV18_7 350 .rev CCACAAACACAAATACAGTTGTT HPV18_7378.for TATTGTCCTGTATTTCAAGTTAT HPV18_ 757 6.rev CGC...
Ngày tải lên: 02/10/2015, 17:15
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... sequence for transglutaminase J Biotechnol 13 1, 12 1 12 7 36 Tarcsa E, Candi E, Kartasova T, Idler WW, Marekov LN & Steinert PM (19 98) Structural and transglutaminase substrate properties of the small ... whereas there was a significant increase in incorporation in the presence of TGase pepK5QN also failed to react with casein in the presence of TGase (data not...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx
... interferon-gamma in response to mitogen, superantigen and recall viral antigen Vet Immunol Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 Immunopathol 1998, ... of antibodies to rpIL-6 Optimization of the antibody titer was conducted using a check board titration of ELISA In each microplate well, Development of a nov...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... Phage # TC-83 TrD P676 3880 Mena II 78V Fe37c BeAn8 Pixuna CaAr508 AG80 Control Figure Reactivity of phagemid clones to a wide range of VEEV strains Reactivity of phagemid clones to a wide range ... into a murine IgG 2a kappa antibody, which was designated CUF37- 2a Murine IgG 2a was chosen as the framework as it has equivalent biological and functional activit...
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf
... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Takahashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, ... corresponding to Aux/IAA genes Motif Transcription Factor Family*1 ([ACGT]GAA [ACGT]){3} TGACAGGT CCAC [AC ]A [ACGT] [AC] [ACGT] [CT] [AC] GG [ACGT]CCCAC GTGG [ACGT]CCC CAACA [ACGT]*CACCTG A [T...
Ngày tải lên: 12/08/2014, 05:20
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI- GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore ... for the development and analysis of test interface for wafer level package operation at multi- gigahertz frequencies (about 2.5 t...
Ngày tải lên: 11/09/2015, 14:24
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering dis...
Ngày tải lên: 12/09/2015, 08:20
Development of a novel method in electroless copper plating
... which are generally anions, such as cynide, are added to increase the plating rate to an acceptable level without causing plating bath instability The plating rate of common electroless plating bath ... ethylenediaminetraacetic acid (EDTA), malic acid (Mal), succinic acid (Suc), tartrate (Tart), citrate (Cit), triethanolamine (TEA) and ethylenediamine (En) (Mallory and Haju, 1990)...
Ngày tải lên: 04/10/2015, 15:52
Báo cáo y học: "Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery" docx
... article as: Kooren et al.: Evaluating the potential of a novel oral lesion exudate collection method coupled with mass spectrometry-based proteomics for oral cancer biomarker discovery Clinical Proteomics ... DeSouza LV, Matta A, Tripathi SC, Ghanny S, DattaGupta S, Thakar A, Chauhan SS, Siu KWM: iTRAQMultidimensional Liquid Chromatography and Tandem...
Ngày tải lên: 13/08/2014, 13:20
The effects of fungal stress on the selected plant seeds and its applications for novel food development
... and developing functional food thereof 1.2 Objectives The overall objective of this research is to study the effects of fungal stress on plant seeds and further study the stressed seeds for novel ... the changes of nutritional profiles of the fungal stressed bean seeds are also evaluated Based on the investigations, the fungal stressed bea...
Ngày tải lên: 14/09/2015, 14:02
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends
... supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel ... some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ester present react...
Ngày tải lên: 05/09/2013, 16:11
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...
Ngày tải lên: 07/03/2014, 16:20
A novel sec7 domain containing protein BIG3 and its role in regulated secretory pathway
... 5’-GAG AAG AAG GAT CCC AGC CGG AAG AAG-3’ and 5’-CGC GTC GAC CAC AAT GAT GTC ATA GAC-3’ and digested with BamHI-SalI and ligated to C-terminal of EcoRI-BamHI fragment in pUC19 The full length of BIG3 ... The interaction of TGN subdomain and motor is selective It can be a direct binding of a cargo protein with a motor protein dynein (Tai et al., 1999); or mediated via ada...
Ngày tải lên: 11/09/2015, 09:15