Development of a new elastic path controller for the collaborative wheelchair assistant
... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... Research Objectives The primary objective of the present study was to develop a new Elastic Path Controller for the Collaborative Wheelchair Ass...
Ngày tải lên: 11/09/2015, 09:59
... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...
Ngày tải lên: 18/06/2014, 22:20
... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATG...
Ngày tải lên: 20/06/2014, 04:20
Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions
... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak depe...
Ngày tải lên: 14/09/2015, 10:36
Development of an elastic path controller for collaborative robot
... the desired path for collaborative robots The kinematics and the elastic path planners for the CWA and Scooter cobot are described in chapters and Simulation of the elastic path controller are ... 3.3 21 21 Elastic Factor as a function of the elastic force and distance to the guiding path 22 3.4 Block diagram of Elastic path controller for Collaborativ...
Ngày tải lên: 04/10/2015, 15:52
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... 5’-GCCAAAATTCGCAGTCCC-3’, 0.5 μM primer hbv460 (antisense) 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the ... RTQ -PCR assay These findings suggest that the ultra sensitive RTQ -PCR assay is equally reliable as the Figure Comparison of the HBV-DNA values estimated using COBAS TaqM...
Ngày tải lên: 12/08/2014, 04:20
Hyperscsi design and development of a new protocol for storage networking
... connection and data reliability mechanism A UDP datagram has a header and a payload The application data is carried as payload and the header carries the necessary information for protocol operation A ... volume of and the increasingly critical role played by data storage, there is a strong demand to put data storage on network Therefore, how to share data, improve...
Ngày tải lên: 16/09/2015, 15:54
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... Risk Management Framework Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...
Ngày tải lên: 28/10/2013, 11:15
báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot
... dyspnoea or sleepiness [2] The lack of research relating to fatigue in this population may be due in part to lack of tools available to accurately measure the experience of fatigue in MND There are ... Summary Analysis figures for Rasch analyses of the NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot
... Team Leader: Dr Tran Xuan Hanh Australian Organisation: Australian Personnel: Australian Animal Health Laboratory (AAHL), PMB 24, Geelong, VIC 3220, Australia Mr Chris Morrissy Date commenced: 01/03/2008 ... culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories to facilitat...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt
... This data- processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware ... updating period of the parameters of µ and x(0) could be based on the basic unit of video frame or audio frame in representing the multimedia data A New Signal...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo khoa học: "Development of a new branchiness index ASIX – A simple tool to describe branchiness in young deciduous forest stand" pps
... development of ASIX had not the aim to create another architectural model The ASIX values are proposed as an additional, very easy, tool to describe and compare tree quality The periodical comparison of ... is affected less by a branch of equal thickness, the growth potential has to be integrated in the model to describe the effect of branchiness on tree qualit...
Ngày tải lên: 08/08/2014, 14:22
báo cáo khoa học: " Implementation of a new cost efficacy method for blood irradiation using a non dedicated device" pptx
... computed and a comparison of the two procedures has been carried out Design of a blood irradiation container and set-up To facilitate and standardize the blood component irradiation using a linear accelerator, ... experience of IRE in the implementation of an internal blood irradiation program using a conventional linear accelerator (LINAC), as an alternative...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx
... phase of measurement, with the aim of developing a valid and reliable patient reported outcome scale for fatigue, the Neurological Fatigue Index (NFIMS) The items in the scale are based on the ... the notion that the sub-dimensions were part of a single, supraordinate theme of neurological fatigue Fit of scale data to the Rasch model also...
Ngày tải lên: 12/08/2014, 01:21