Dynamics of liver fatty acid binding protein

... holo -liver fatty acid binding protein 14 2.1.2.2 Structural studies on apo -liver fatty acid binding protein 15 2.1.3 A brief summary 15 2.2 Characterization of the dynamics of fatty acid binding proteins ... holo-intestinal fatty acid binding protein 11 2.1.1.2 Structural studies on apo-intestinal fatty acid binding protein 12 2.1.2 Structural s...

Ngày tải lên: 11/09/2015, 09:59

... Spatio-temporal distribution of cellular retinol-binding protein gene transcripts (CRBPI and CRBPII) in the developing and adult zebrafish (Danio rerio) Eur J Biochem 271, 339–348 Ohmachi T, Inoue ... Alves-Costa et al The zebrafish fabp6 gene Distribution of fabp6 gene transcripts in zebrafish embryos and larvae Fig A neighbor-joining tree sho...

Ngày tải lên: 07/03/2014, 06:20

... show differential tissue-specific distribution of fabp10a and fabp10b transcripts in developing and adult zebrafish, evidence of the divergence of regulatory elements in the promoters of the fabp10a ... vesicles indicates a potential role for this protein in the early development of the zebrafish brain Tissue-specific distribution of fabp10b ge...

Ngày tải lên: 16/03/2014, 00:20

... AGCAATAG and 596– ACGAGGAAGCGAAGGATGA TGATGG) were chosen to amplify a 139-base pair fragment of the plFABP Primers specific to the crayfish ribosomal 40S gene (156+ GACGAATGGCATACACCTGAG AGG and ... binding of RA and ⁄ or fatty acid molecules The biological roles of these proteins span over a wide range of processes such as transport, cellular uptake and cytoplasmic tra...

Ngày tải lên: 23/03/2014, 10:21

... binding protein activator protein activator protein activator protein )3 4 )6 6 )1 26 )2 38 )4 35 )5 22 )7 88 )9 63 )8 77 )9 11 )1 064 )1 47 )1 091 )1 122 )1 203 )1 77 )6 72 )9 40 )2 00 )5 61 )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 ... )6 60 )7 71 )8 58 )2 10 )5 97 )7 36 )9 29 ( ) ( )...

Ngày tải lên: 31/03/2014, 07:20

... )2 97 )8 91 )3 33 )6 35 )6 71 )8 89 )3 63 )9 55 )7 60 )9 74 )1 099 )1 082 )1 198 ( +) ( +) ( ) ( ) ( +) ( ) ( +) ( +) ( +) ( ) ( +) ( ) ( ) ( ) ( ) ( +) ( +) 1.000 0.976 0.881 1.000 1.000 0.806 1.000 1.000 1.000 1.000 ... Denovan-Wright, E.M & Wright, J.M (200 3) Structure, mRNA expression and...

Ngày tải lên: 31/03/2014, 07:20

... Ras bound to GTPcS A B Fig Conformational equilibria of wild-type Ras and Ras mutants complexed with Mg2+ GTPcS (A) The sample contained mM Ras( wt)•Mg2+ GTPcS (lower), 1.2 mM Ras( T35S)•Mg2+ GTPcS ... between the corresponding T2 relaxation times for the conformational states 1a and 1b of Ras( T35S)•Mg2+ GTPcS Complex of Ras Mg2+ GTPcS with the Ras-...

Ngày tải lên: 30/03/2014, 09:20

... interaction of fatty acid binding domain of BSA molecule with stearic acid As the synthesized magnetic nanoparticle was capped with stearic acid molecule, it can effectively help in the formation of bioconjugate ... synthesis of bioconjugate of maghemite nanoparticles with BSA molecule by using the covalent interaction between the fatty acid binding domai...

Ngày tải lên: 22/06/2014, 01:20

... cloning and developmental expression of cellular nucleic acid- binding protein (CNBP) gene in Xenopus laevis Gene 241, 35–43 21 Flink IL, Blitz I & Morkin E (1998) Characterization of cellular nucleic ... role in the regulation of CNBP biochemical activities CNBP is phosphorylated in vitro by embryonic kinases To facilitate the biochemical characte...

Ngày tải lên: 16/03/2014, 12:20

... detection of cellular retinoic acid binding proteins I and 3570 R.-Z Liu et al 15 16 17 18 19 20 21 22 23 24 25 26 27 28 II with new antibodies J Histochem Cytochem 46, 11 03 11 11 Zetterstrom RH, Lindqvist ... (19 90) Retinoic acid receptors and cellular retinoid binding proteins I A systematic study of their differential pattern of transcription during mouse organo...

Ngày tải lên: 16/03/2014, 22:20

... retinoic acid- binding protein II and retinoic acid receptor sensitizes mammary carcinoma cells to retinoic acidinduced growth arrest Mol Cell Biol 2002, 22:2632-2641 Noy N: Retinoid -binding proteins: ... expression of Crabp2 is generally linked to activation of the retinoid pathway either directly, because expression of Crabp2 is regulated by retinoic acid, or...

Ngày tải lên: 09/08/2014, 01:22

... investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and ... relatively higher in mahua biodiesel than that of biodiesel of palm In addition to unsaturation, ignition delay increases with fuel density and iodine value The effect...

Ngày tải lên: 05/09/2013, 15:28

... homologous liver zebrafish protein, where the introduction of a disulfide bridge resulted, intriguingly, in a singly ligated protein, with the cholate occupying the more superficial binding site [16] ... lead to distinct binding and functional properties [22,23] In line with this, we have shown here that the presence of a disulfide bridge, while maintaining the same binding stoichi...

Ngày tải lên: 18/02/2014, 06:20

... ratios: at a : Fe2+ ⁄ protein ratio, the resonances of Arg20, Asp22 and Asp23 disappeared, and the resonance of Leu21 shifted At a : ratio, the resonances of residues 19 and 44 also disappeared, ... spectrum of CyaY, but the most striking consequence of the addition was the total disappearance of specific resonances without the concomitant appearance of other...

Ngày tải lên: 18/02/2014, 16:20

... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the ot...

Ngày tải lên: 07/03/2014, 21:20