Compactly supported basis functions as support vector kernels capturing feature interdependence in the embedding space
... equally spaced observations of a hypothetical continuous signal By approximating the signal with compactly supported basis functions (CSBF) and employing the inner product of the embedding L2 space, ... encoded as binary in order to avoid the bias that entropic measures have toward features with many values This can greatly increase the number of features in the o...
Ngày tải lên: 11/09/2015, 09:57
... study was limited in its scope, the results indicate that WNV strain IS-98-ST1 is suitable as viral model for West Nile encephalitis in the Old World The Israeli strain IS-98-ST1 that caused the ... the fact that an Israeli WNV strain was introduced in New York City in 1999 [4] The murine model of WNV-associated encephalitis has been wid...
Ngày tải lên: 18/06/2014, 22:20
... at the first element of p, pk At this point, the top of the stack is the index of the last element of q encountered We move the top of the stack out, as the first entry of the right list Since ... with parking functions, stack-sortable permutations, or with parameterizing spaces of paths in the Johnson graph? the electronic journal of combinat...
Ngày tải lên: 07/08/2014, 07:21
báo cáo khoa học: "Necrotizing sialometaplasia as a cause of a nonulcerated nodule in the hard palate: a case report" pot
... [2,3] In the present case, the biopsy was obtained at an early stage of the disease, a fact that may explain the absence of an ulcer Squamous metaplasia of the ductal epithelium, accompanied ... Necrotizing sialometaplasia as a cause of a non-ulcerated nodule in the hard palate: a case report Journal of Medical Case Reports 2011 5:406 Conclus...
Ngày tải lên: 10/08/2014, 23:20
phân loại văn bản bằng phương pháp support vector machine
... dựng ứng dụng phân loại văn 1.4.10 Hành vi giả thuyết Hầu hết phương pháp phân loại văn chuẩn cho mục tiêu phân loại văn gán tài liệu tới nhiều phân loại, ngược lại coi phân loại nhị phân Tất nhiên, ... phân loại văn 58 PHẦN II - THỬ NGHIỆM PHÂN LOẠI VĂN BẢN TRONG ORACLE BẰNG PHƯƠNG PHÁP SVM 59 CHƯƠNG PHÂN LOẠI VĂN BẢN VỚI ORACLE TEXT 60 4.1 Khai phá văn...
Ngày tải lên: 19/02/2014, 09:07
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc
... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation ... PLD1 generation of PA H2O2 can participate in many signaling pathways, including both pro-apoptotic and anti-apoptotic ones PrxII is proposed here to function as a signal terminator, el...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "Support Vector Machines for Query-focused Summarization trained and evaluated on Pyramid data" ppt
... Nenkova and R Passonneau 2004 Evaluating content selection in summarization: The pyramid method In Proc HLT/NAACL 2004, Boston, USA A Nenkova and L Vanderwende 2005 The impact of frequency on summarization ... III and Daniel Marcu 2005 Bayesian summarizae tion at DUC and a suggestion for extrinsic evaluation In Proc DUC-2005, Vancouver, Canada S Fisher and B Roark 2006 Que...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Reading Level Assessment Using Support Vector Machines and Statistical Language Models" pdf
... Reading Level Assessment This section highlights examples and features of some commonly used measures of reading level and discusses current research on the topic of reading level assessment using ... syntactic and semantic analysis Statistical language models (LMs) are used successfully in this way in other areas of NLP such as speech recognition and machine translati...
Ngày tải lên: 20/02/2014, 15:20
Gene Selection for Cancer Classification using Support Vector Machines pot
... computed for support vectors only, which makes it affordable for small numbers of support vectors Additionally, parts of the calculation such as the dot products xh.xk between support vectors ... criterion is computed with information about a single feature III Feature ranking with Support Vector Machines III.1 Support Vector Machines (SVM) To test the idea of using th...
Ngày tải lên: 06/03/2014, 00:22
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindII...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...
Ngày tải lên: 14/03/2014, 23:20
Phương pháp học máy với Support vector machine trong nhận dạng chữ viết tay trực tuyến
Ngày tải lên: 14/03/2014, 23:35
Báo cáo khoa học: "An Empirical Study of Active Learning with Support Vector Machines for Japanese Word Segmentation" pptx
... ề ẵ ĩà ôí ẳ Active Learning for Support Vector Machines 3.1 General Framework of Active Learning We use pool-based active learning (Lewis and Gale, 1994) SVMs are used here instead of probabilistic ... show that SVM active learning works well for Japanese word segmentation, which is one of such complex tasks, and the naive use of a large pool with the p...
Ngày tải lên: 17/03/2014, 08:20