development of new human stem cell derived cellular vehicles for glioma gene therapy
... DEVELOPMENT OF NEW HUMAN STEM CELLDERIVED CELLULAR VEHICLES FOR GLIOMA GENE THERAPY ZHAO YING (B Sc., PKU; M Sc., PKU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF ... stem cells by adherent monoculture 4.3.2 “Stemness” of human embryonic stem cell- derived neural 127 stem cells 4.3.3 In vitro glioma tropism evaluation o...
Ngày tải lên: 11/09/2015, 09:00
... Ng W H , Wang S 4 .Human embryonic stem cell- derived mesenchymal stem cells as cellular delivery vehicles for prodrug gene therapy of glioblastoma Human gene therapy , Volume 22 , Issue 11 (2011) ... Pluripotent stem cells 19 20 20 1.2.1.1.1 Embryonic stem cells 20 1.2.1.1.2 Induced pluripotent stem cells 21 1.2.1.2 Adult stem cells 23 1.2.1.2.1 Mesenchyma...
Ngày tải lên: 09/09/2015, 10:08
... DEVELOPMENT OF NEW NEURAL STEM CELL- BASED TUMOR- TARGETED GENE THERAPY APPROACHES ZHU DETU (B Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL ... study aims to develop new NSC -based tumor- targeted gene therapy that improves the treatment of patients with breast cancer and overcomes the hurdles faced by stem...
Ngày tải lên: 09/09/2015, 10:06
Báo cáo y học: "Transcriptomic and phenotypic analysis of murine embryonic stem cell derived BMP2+ lineage cells: an insight into mesodermal patterning" ppt
... Expression of genes in the BMP2+ cells associated with plasticity, and mesodermal and NCSC phenotypes BMP2+ cells are still in a state of plasticity BMP2+ cells significantly upregulate Oct4 and Nanog ... 50 µm 20 µm Analysis neural crest stem cell associated transcripts in BMP2+ cells Figure of Analysis of neural crest stem cell associated transcripts in...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Global transcriptome analysis of murine embryonic stem cell-derived cardiomyocytes" doc
... belong to the KEGG pathway 'cell cycle' and to the GO category 'cell cycle' As indicated several cyclins (cyclin A1, cyclin A2, cyclin B1, cyclin B2, cyclin D1, cyclin D2, and cyclin E1) are downregulated ... significantly contribute to an understanding of cardiomyocyte-specific physiologic processes Results and discussion Isolation of highly purified α-MHC+ cardiomyocytes from the transg...
Ngày tải lên: 14/08/2014, 20:22
Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy
... astrocytoma grades I, II [astrocytoma], III [anaplastic astrocytoma] and IV [glioblastoma or GM]), oligodendrogliomas, ependymomas and mixed gliomas Gliomas constitute 77% of the primary malignant brain ... the characterization of a glioblastoma specific promoter This study deals with the identification, isolation and characterization of a glioblastoma specific...
Ngày tải lên: 22/10/2015, 21:20
Báo cáo y học: " Comprehensive transcriptome analysis of mouse embryonic stem cell adipogenesis unravels new processes of adipocyte development" ppt
... Billon et al.: Comprehensive transcriptome analysis of mouse embryonic stem cell adipogenesis unravels new processes of adipocyte development Genome Biology 2010 11:R80 Submit your next manuscript ... Maintenance of pluripotential embryonic stem cells by stem cell selection Reprod Fertil Dev 1998, 10:527-533 53 Wdziekonski B, Villageois P, Dani C: Differe...
Ngày tải lên: 09/08/2014, 20:22
Development of human stem cell based model for developmental toxicity testing
... toxicity 15 2.2.2 In vivo animal studies for developmental toxicity testing 17 2.3 In vitro animal -based models for developmental toxicity testing 18 2.3.1 The MM assay 19 2.3.2 ... However, current animal -based models for developmental toxicity testing is limited by time, cost and high inter-species variability, while human pluripotent stem cell (hPSC) mod...
Ngày tải lên: 09/09/2015, 08:18
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...
Ngày tải lên: 09/09/2015, 18:56
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders
... source of cells and the potential to derive the cell type of interest together with the possibility to enrich for genetic modifications during the dividing stem cell state 1.1.1 Human pluripotent stem ... stem cells Landmark discoveries of the young field of human stem cell science were the isolation and culture of inner cell mass from hu...
Ngày tải lên: 26/11/2015, 09:54
Báo cáo hóa học: " Modulation of the major histocompatibility complex by neural stem cell-derived neurotrophic factors used for regenerative therapy in a rat model of stroke" ppt
... with an intra-peritoneal injection of 400 mg/kg chloral hydrate (Pharmaceutical Plant of Tiantan Hospital, Beijing, China) The rectal temperature was monitored and maintained at 37.5°C A scalp incision ... infarcted brain parenchyma of transplanted rats (A- iii and A- iv) A comparable extent of class II MHC was noted in ischemic rats irrespective of any therapy but unrema...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: "Discovery of a new human T-cell lymphotropic virus (HTLV-3) in Central Africa" potx
... 85:507-519 Mahieux R, Pecon-Slattery J, Gessain A: Molecular characterization and phylogenetic analyses of a new, highly divergent simian T-cell lymphotropic virus type (STLV-1marc1) in Macaca arctoides ... B, Vandamme AM, Heneine W, Switzer WM: Identification in gelada baboons (Theropithecus gelada) of a distinct simian T-cell lymphotropic virus type with a broad...
Ngày tải lên: 13/08/2014, 09:21
Human embryonic stem cell derived neural stem cells derivation, differentiation and MicroRNA regulation
... HUMAN EMBRYONIC STEM CELL- DERIVED NEURAL STEM CELLS: DERIVATION, DIFFERENTIATION AND MICRORNA REGULATION KWANG WEI XIN TIMOTHY (B.Sc (Hons), NUS) ... mechanisms of regulation of NSC differentiation 1.1.5.2 Pluripotent stem cell- derived NSCs Human embryonic stem cells (hESCs), which are pluripotent cells derived from the inner cell mass of blast...
Ngày tải lên: 10/09/2015, 09:08
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
... center The New Town includes three components: Bac Linh Dam (North of Linh Dam) , Linh Dam peninsula in the middle and Linh Dam expansion (South of Linh Dam) The success of the project has set the ... south-west of Linh Dam lake with higher density of construction 665 Linh Dam new town - Solution for the High-density devel...
Ngày tải lên: 29/08/2013, 08:15
LINH DAM NEW TOWN - SOLUTION FOR THE HIGH-DENSITY DEVELOPMENT OF NEW SETTLEMENTS IN THE SOUTH-WEST OF HANOI
... nặng nhọc với mức thu nhập thấp, kéo theo điều kiện sống mức tối thiểu, tạm bợ khu nhà trọ rẻ tiền với điều kiện sinh hoạt an ninh không đảm bảo Đời sống tinh thần lao động hạn chế Họ thấy cô ... có xu hướng linh hoạt phụ thuộc nhiều vào mặt hàng họ bán “độ đắt hàng” Trung bình họ làm việc 13,09 giờ/ngày lúc bắt đầu công việc từ 2h30 - 3h00 sáng mặt hàng họ bán rau, hoa, quả… - 7h s...
Ngày tải lên: 29/08/2013, 08:15