Branched polyethylene glycol for protein precipitation

... Engineering Title: Branched Polyethylene Glycol for Protein Precipitation Supervisor: Professor Reginald B.H TAN Abstract The use of linear polyethylene glycol (PEG) for protein precipitation raises ... NCBI National Center for Biotechnology Information nm Nanometer P Pressure Pa Pascal PBS Phosphate buffered saline PE Polyethylene PEG Polyethylene glycol PEG6000...

Ngày tải lên: 10/09/2015, 15:52

... compositions, methods of making thereof, and methods of using thereof An illustrative embodiment of the invention relates to the oxidation of polyethylene glycol derivatives having the formula: ##STR1## ... environmentally friendly In view of the foregoing, it will be appreciated that providing an efficient, gentle method for preparation of polyethylene glycol ald...

Ngày tải lên: 23/08/2015, 17:41

... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... Use of Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analy...

Ngày tải lên: 25/10/2012, 11:00

... - SỐ 3(26).2008 Kết thảo luận 3.1 Nghiên cứu yếu tố ảnh hưởng đến khả chịu lực màng tinh bột có phối trộn PEG phương pháp luân phiên biến: Có nhiều yếu tố ảnh hƣởng đến khả chịu lực màng tinh ... đo khả - Sử dụng phƣơng pháp luân phiên chịu lực màng [4] biến, để nghiên cứu động thái yếu tố ảnh hƣởng đến khả chịu lực mà...

Ngày tải lên: 16/11/2012, 14:25

... thông số tốt cho trình tạo màng tinh bột sắn có bổ sung etylenglycol (màng TBS-PEG) nồng độ tinh bột sắn 10,9%, nồng độ PEG 0,35%, thời gian hồ hóa 16 phút 30 giây, màng tinh bột đạt đƣợc độ bền ... xuất màng bao bì thực phẩm nhằm thay chất dẻo khó phân hủy, có ý nghĩa kinh tế - xã hội cao vô cấp thiết Mục tiêu nghiên cứu tạo nên màng mỏng bao go...

Ngày tải lên: 19/11/2012, 12:38

... A system for protein evolution based on cell-free translation An initial DNA library is used as the template for cell-free translation Following genotype–phenotype (RNA protein or DNA protein) ... cellular models [25] Indeed, when Cell-free translation for protein engineering functional protein synthesis occurs inside liposomes, it provides a platform for simulati...

Ngày tải lên: 19/02/2014, 06:20

... 1984] Improving protein nutrition is the second strategy for increasing production in ruminants with a high protein requirements These include young animals following weaning, cows in the last ... weight The potential for ruminant production to be increased from poor quality forages is of the order of 5-10 fold without any increase in the demand for forage To attain su...

Ngày tải lên: 08/03/2014, 23:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTA...

Ngày tải lên: 16/03/2014, 16:20

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

... A ThermofluorÒ-adapted flavin ad hoc detection system F Forneris et al A B C Fig (A) Schematic representation of the ThermofluorÒ binding assay A solvatochromic dye (i.e SYPRO Orange) is used as ... named this modified ThermofluorÒ approach ‘ThermoFAD’ (ThermofluorÒ-adapted flavin ad hoc detection system) Results The ThermoFAD technique A ThermoFAD analysis requires...

Ngày tải lên: 23/03/2014, 04:21

... or more replicate experiments A 6xHis 4AaCter-TpN15 PP TpN15 B TpN17 4AaCter 4AaCter 4AaCter-TpN17 4AaCter 4AaCter-TpN47 4AaCter TpN47 4AaCter 4AaCter TpN15 TpN17 TpN47 ATG Ptac (kDa) 210 119 90 ... (Invitrogen, Carlsbad, CA, USA) and incubated with PreScission protease at a concentration of UÆ100 lg)1 protein to remove the · His–4AaCter tag The released · His–4AaCter tag and undige...

Ngày tải lên: 29/03/2014, 09:20

... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear depen...

Ngày tải lên: 29/03/2014, 09:20

... 3.1 Nghiên cứu yếu tố ảnh hưởng đến khả chịu lực màng tinh bột có phối trộn PEG phương pháp luân phiên biến: Có nhiều yếu tố ảnh hưởng đến khả chịu lực màng tinh bột, nghiên cứu đề cập đến yếu ... PHÁP XÁC ĐỊNH KHẢ NĂNG CHỊU LỰC CỦA MÀNG 2.2.2 PHƯƠNG PHÁP TOÁN HỌC - Sử dụng phương pháp luân phiên biến, để nghiên cứu động thái yếu tố ảnh...

Ngày tải lên: 04/05/2014, 22:15