Branched polyethylene glycol for protein precipitation

Branched polyethylene glycol for protein precipitation

Branched polyethylene glycol for protein precipitation

... Engineering Title: Branched Polyethylene Glycol for Protein Precipitation Supervisor: Professor Reginald B.H TAN Abstract The use of linear polyethylene glycol (PEG) for protein precipitation raises ... NCBI National Center for Biotechnology Information nm Nanometer P Pressure Pa Pascal PBS Phosphate buffered saline PE Polyethylene PEG Polyethylene glycol PEG6000...

Ngày tải lên: 10/09/2015, 15:52

143 348 0
Method for preparation of polyethylene glycol aldehyde derivatives

Method for preparation of polyethylene glycol aldehyde derivatives

... compositions, methods of making thereof, and methods of using thereof An illustrative embodiment of the invention relates to the oxidation of polyethylene glycol derivatives having the formula: ##STR1## ... environmentally friendly In view of the foregoing, it will be appreciated that providing an efficient, gentle method for preparation of polyethylene glycol ald...

Ngày tải lên: 23/08/2015, 17:41

12 312 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy of ... Use of Laboratory Animals Statistical analysis The results were recorded by the principal investigator and analyzed statistically upon completion of the study The statistical analy...

Ngày tải lên: 25/10/2012, 11:00

7 453 0
Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

Tài liệu Báo cáo khoa học: Cell-free translation systems for protein engineering docx

... A system for protein evolution based on cell-free translation An initial DNA library is used as the template for cell-free translation Following genotype–phenotype (RNA protein or DNA protein) ... cellular models [25] Indeed, when Cell-free translation for protein engineering functional protein synthesis occurs inside liposomes, it provides a platform for simulati...

Ngày tải lên: 19/02/2014, 06:20

8 612 0
REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot

REQUIREMENTS FOR PROTEIN MEALS FOR RUMINANT MEAT PRODUCTION IN DEVELOPING COUNTRIES pot

... 1984] Improving protein nutrition is the second strategy for increasing production in ruminants with a high protein requirements These include young animals following weaning, cows in the last ... weight The potential for ruminant production to be increased from poor quality forages is of the order of 5-10 fold without any increase in the demand for forage To attain su...

Ngày tải lên: 08/03/2014, 23:20

28 423 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTA...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... defined as physiological substrates for each protein kinase Specifically, protein phosphatase inhibitor-1 was used in the PKA, MAPK, Cdk1 and Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation ... migrating bands are Ó FEBS 2004 Recombinant mouse AK as a protein phosphorylation target (Eur J Biochem 271) 3551 Fig Phosphorylation of recombina...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf

... A ThermofluorÒ-adapted flavin ad hoc detection system F Forneris et al A B C Fig (A) Schematic representation of the ThermofluorÒ binding assay A solvatochromic dye (i.e SYPRO Orange) is used as ... named this modified ThermofluorÒ approach ‘ThermoFAD’ (ThermofluorÒ-adapted flavin ad hoc detection system) Results The ThermoFAD technique A ThermoFAD analysis requires...

Ngày tải lên: 23/03/2014, 04:21

8 465 0
Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx

... or more replicate experiments A 6xHis 4AaCter-TpN15 PP TpN15 B TpN17 4AaCter 4AaCter 4AaCter-TpN17 4AaCter 4AaCter-TpN47 4AaCter TpN47 4AaCter 4AaCter TpN15 TpN17 TpN47 ATG Ptac (kDa) 210 119 90 ... (Invitrogen, Carlsbad, CA, USA) and incubated with PreScission protease at a concentration of UÆ100 lg)1 protein to remove the · His–4AaCter tag The released · His–4AaCter tag and undige...

Ngày tải lên: 29/03/2014, 09:20

9 371 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear depen...

Ngày tải lên: 29/03/2014, 09:20

29 406 0
nghiên cứu một ôs yêu cầu ảnh hưởng đến khả năng chịu lực của màng bao gói thực phẩm được chế tạo từ tinh bột sắn có bổ sung polyethylene glycol (peg)

nghiên cứu một ôs yêu cầu ảnh hưởng đến khả năng chịu lực của màng bao gói thực phẩm được chế tạo từ tinh bột sắn có bổ sung polyethylene glycol (peg)

... 3.1 Nghiên cứu yếu tố ảnh hưởng đến khả chịu lực màng tinh bột có phối trộn PEG phương pháp luân phiên biến: Có nhiều yếu tố ảnh hưởng đến khả chịu lực màng tinh bột, nghiên cứu đề cập đến yếu ... PHÁP XÁC ĐỊNH KHẢ NĂNG CHỊU LỰC CỦA MÀNG 2.2.2 PHƯƠNG PHÁP TOÁN HỌC - Sử dụng phương pháp luân phiên biến, để nghiên cứu động thái yếu tố ảnh...

Ngày tải lên: 04/05/2014, 22:15

22 1,7K 4
w