a domain for protein protein interaction

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... (PPM) and phosphoamino acid analysis (PAAA) of mAK-L preparatively phosphorylated by PKC (E) Site-directed mutagenesis analysis of PKC phosphorylation of mAK-L The Coomassie stain and autoradiogram ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable...

Ngày tải lên: 16/03/2014, 18:20

9 497 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table Plasmids used in this study Plasmid Description Source YCplac111 pGEX5X-1 ... morphology in mammalian cells Mol Biol Cell 11, 747–763 16 Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1...

Ngày tải lên: 23/03/2014, 09:20

14 362 0
Báo cáo y học: "A human functional protein interaction network and its application to cancer data analysis" potx

Báo cáo y học: "A human functional protein interaction network and its application to cancer data analysis" potx

... non-Reactome human-curated pathway databases were imported into the Reactome database (28 March 2009 release) These four databases are: Panther [27], CellMap [61], NCI Pathway Interaction Database ... Phani Garapati, Marc Gillespie, Gopal Gopinath, Jill Hemish, Henning Hermjakob, Bijay Jassal, Alex Kanapin, Suzanna Lewis, Shahana Mahajan, Lisa Matthews, Bruce May, Esther Schmidt, and Imre Vastrik ... high-coverage, unreliable pairwise data sets with low-coverage, highly reliable pathways to create a pathway-informed data analysis system for high-throughput data analysis As the first step towards achieving...

Ngày tải lên: 09/08/2014, 20:22

23 403 0
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

... Nosema ceranae 100 Nosema ceranae 100 Encephalitozoon cuniculi Antonospora locustae 99 100 97 100 Paranosema grylli ATP transporters Clade I Antonospora locustae Antonospora locustae Ancestral ATP ... (NCBI) non-redundant database However, 25 of these showed significant similarities with hypothetical proteins from the A locustae database, indicating that O bayeri and A locustae share a number of ... from Spraguea lophii [35], Vittaforma cornea [36], Edhazardia aedis, and Brachiola algerae [37,38], but because of their very low sequence coverage no conclusion can be drawn about their overall...

Ngày tải lên: 09/08/2014, 20:20

12 400 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx

... (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) ... recombinant proteins at a desirable level and ratio, these procedures are time consuming as well as labor intensive Therefore, FRET assays using stable-transformed cells are unlikely to be a popular ... interaction between GnRH-R molecules The effect of a GnRH agonist and antagonist on GnRHR association has also been examined The data showed that FRET was enhanced by the addition of a GnRH agonist...

Ngày tải lên: 30/03/2014, 20:20

9 380 0
Báo cáo hóa học: " Domain-Based Predictive Models for Protein-Protein Interaction Prediction" docx

Báo cáo hóa học: " Domain-Based Predictive Models for Protein-Protein Interaction Prediction" docx

... to find domains in new proteins The Pfam database consists of two parts: PfamA and Pfam-B Pfam -A is manually curated, and Pfam-B is automatically generated Both Pfam -A and Pfam-B families are used ... considered as a single -domain protein if it has only one domain and the domain accounts for at least 50% of the protein length The domain interactions derived from single -domain protein interactions are ... negative samples The protein domain information was gathered from Pfam [40], a protein domain family database, which contains multiple sequence alignments of common domain families Hidden Markov...

Ngày tải lên: 22/06/2014, 23:20

8 339 0
báo cáo khoa học: "A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity" docx

báo cáo khoa học: "A single amino acid change within the R2 domain of the VvMYB5b transcription factor modulates affinity for protein partners and target promoters selectivity" docx

... CCCACAATATAAGCCCAAGC 126 NtANS EB427369 F: TCCATCTGGCCTAAAATCCCT R: AACGCCAAGTGCTAGTTCTGG 226 NtDFR EF421429 F: CGCGTCCCATCATGCTATC R: AATACACCACGGACAAGTCC 116 NtUbiquitin NTU66264 F: GAAAGAGTCAACCCGTCACC ... the manufacturer’s instruction The coding sequences were amplified with Turbo-Pfu (Stratagene) using the following primers pairs: F, 5’AGATCCTAATACGACTCACTATAGGGAGCCACCATGAGGAATGCATCCTCAGCA and ... Abe Y, Kakizaki Y, Yamamoto K, Shimada N, Yamamura S, Nishihara M: Identification and characterization of R2R3-MYB and bHLH transcription factors regulating anthocyanin biosynthesis in gentian...

Ngày tải lên: 11/08/2014, 11:21

14 383 0
Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx

... fibrosis; P aeruginosa PAO1 was isolated from a wound [32] P aeruginosa is a versatile Gram-negative bacterium that also thrives in soil, marshes and coastal marine habitats, and on plant tissues ... the computational aspect Additional data files The following additional data are available with the online version of this paper Additional data file is a figure that shows the reliability of ... validate this method using named proteins where functional information was available While this is appropriate for method validation, the disadvantage is that there are problems with annotation...

Ngày tải lên: 14/08/2014, 08:20

13 388 0
Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

... co-expression and GO distance, which are noisy sensors for the actual interaction variable Tij.I Note that an actual interaction variable may have several observation variables if the pair appears in ... allow for variations in false positive and false negative rate [25,80], and for confidence scores accompanying certain assays [2,4] There may be multiple observation variables attached to a protein ... interactions in any data set, increasing the amount of available data by orders of magnitude, and reducing the potential for bias The same EM algorithm also trains the affinity parameters for...

Ngày tải lên: 14/08/2014, 08:20

18 251 0
Báo cáo y học: "A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network" doc

Báo cáo y học: "A scale of functional divergence for yeast duplicated genes revealed from analysis of the protein-protein interaction network" doc

... individual class members for which a functional annotation is available Classes of proteins are then analyzed for their biological relevance and tested for their statistical robustness (see Materials ... binding, far western, gel retardation and biochemical experiments) Additional data files The following additional data are available with the online version of this paper Additional data file contains ... divergence for the duplicated genes based on the protein- protein network analysis This work validates the use of interaction data and the analysis of interaction networks as a new means of investigating...

Ngày tải lên: 14/08/2014, 14:21

13 209 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

... of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and TAB2 TAB2, an adaptor linking TAK1 to TRAF6, is associated with cell membrane under unstimulated conditions ... via all the TLRs TIRAP/Mal is a second TIR domain- containing adaptor that specifically mediates the MyD88-dependent pathway via TLR2 and TLR4 In the TLR4 and TLR3mediated signaling pathways, a ... MyD88-independent pathway exists that leads to activation of IRF-3 via TBK1 and IKKε/IKKi The TIR domain- containing adaptor TRIF mediates this MyD88-independent pathway Adopted from Takeda and Akira et al.,...

Ngày tải lên: 12/09/2015, 08:20

236 494 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... individual proteins in a pool of folded variants In addition, a rapid method for quantitatively, and simultaneously, characterizing a large number of mutants would greatly aid in understanding...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

Báo cáo khoa học: Gc recruitment system incorporating a novel signal amplification circuit to screen transient protein-protein interactions pot

... were extracted, and the target ZI3 1A gene was amplified by PCR with primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by ... Gccyto–Fc fusion protein and several membrane-localized Z -domain variants as interaction models with a wide range of affinity constants with the same genotypes as the parental strains (Table 1) Using ... including global changes in transcription, a reporter gene assay and mating selection are available (Fig 1A) [12] Unlike stable interactions, however, transient interactions cannot generally transmit...

Ngày tải lên: 05/03/2014, 23:20

9 536 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... CGGGGATCCGCATCGGAACAAAACAATAC AATCCCGGGTTACTTTAGTTTATCTTTGCCG GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA ... CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC ... CCCAAGCTTGATGATGTCAGC CCCAAGCTTGAACGCCTTCATAGTGTC BamHI SmaI BamHI SmaI BamHI SmaI BamHI SmaI a Restriction sites used for cloning are shown in italic b Nucleotides changed for site-directed mutagenesis...

Ngày tải lên: 06/03/2014, 00:20

13 514 0
Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

Báo cáo khoa học: A zinc finger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

... normalized against the input DNA Stable knock-down of ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA ... amplification of a 230-bp fragment of the apoCIII promoter, with the forward primer (TCTCCTAGGGATTTCCCAACTCTCC) and the reverse primer (CTGCCTCTAGGGATGAACTGAGCAG) Quantitative real-time PCR was ... distribution analysis of human ZNHIT-1 blastp of human ZNHIT-1 was performed at National Center for Biotechnology Information (NCBI) sites, Fig Evaluation of the interaction strength by a relative b-galactosidase...

Ngày tải lên: 07/03/2014, 05:20

12 423 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

... D-Ala-Gly, D-Ala-(Gly)2 (D-Ala)2, D-Ala-L-Ala (D-Ala)3 (D-Ala)4, L-Ala-Gly, L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has ... (BapA) acting on d-Ala-pNA was purified and characterized BapA was found to show a unique substrate specificity for b-alanyl dipeptides H Komeda and Y Asano Results Characterization of the flanking...

Ngày tải lên: 07/03/2014, 21:20

10 406 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... term was used for global symmetry NOEs, a quadratic harmonic potential term was used for noncrystallographic symmetry (NCS) restraints and a quadratic harmonic potential term was used for packing ... used for secondary structure evaluation, solvent accessibility calculation, angular order parameters calculation, inter-helical angle calculation, and for protein structure figure preparation ... dimerization and docking domain This could allow the interdomain/cAMP binding region to pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part...

Ngày tải lên: 08/03/2014, 22:20

12 536 0
Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc

Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc

... on plasma membrane regulates T cell adhesion J Cell Biol 164, 461–470 Fujita H, Fukuhara S, Sakurai A, Yamagishi A, Kamioka Y, Nakaoka Y, Masuda M & Mochizuki N (2005) Local activation of Rap1 ... exchange factors for Rac [6] ARAP3 is a GTPase-activating protein for RhoA and Arf6 that affects PDGF-induced lamellipodia formation [7] In dictyostelium, Phg2 promotes myosin II disassembly at ... supernatant was incubated with mouse anti-FLAG M2 coupled to agarose beads (Sigma Aldrich, L’Isle d’Abeau Chesnes, France) for h at °C FLAG-Krit1 trapped on beads was incubated with lm of Rap1GTPcS,...

Ngày tải lên: 16/03/2014, 05:20

15 329 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx

... site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA G-3¢ and 5¢-CTT AGG AGA TGT AGG ACC CAG TGT CCT TTT G-3¢) To create pStrep–BroxC408S ... AAA GAC CCC AAC GAG AAG CGC GAT CAC-3¢ and 5¢-GTG ATC GCG CTT CTC GTT GGG GTC TTT GCT CAG CTT GGA CTG-3¢) pmGFP–Brox C408S , which has a point mutation at amino acid 408, was created by PCR-based ... motif, C standing for cysteine, A for generally aliphatic amino acid, and X for any amino acid)] in this article, is a 411 amino acid Association of Brox with CHMP4 residue hypothetical protein...

Ngày tải lên: 16/03/2014, 06:20

11 412 0
Xem thêm
w