The role of serum amyloid A1(SAA1) in coronary artery disease

The role of serum amyloid a in atherosclerosis

The role of serum amyloid a in atherosclerosis

... minimization of tissue damage and promotion of healing (Baranova et al., 2010; Sandri et al., 2008) In the event of a tissue injury, the acute phase response initiates the activation of a cascade, ... indication of the involvement of macrophages in plaque rupture (Boyle, 2005) 1.3 Serum Amyloid A (SAA) SAA is a 12.5kDa acute phase reactant which plays a...

Ngày tải lên: 12/10/2015, 17:36

172 352 0
The role of serum amyloid A1(SAA1) in coronary artery disease

The role of serum amyloid A1(SAA1) in coronary artery disease

... facilitating its growth and hence angiogenesis is pro-atherogenic The final stage in the development of an atheroma involves the rupturing of a plaque Plaque rupturing involves the erosion of the ... important for the binding of SAA1 to components of the extracellular matrix (Uhlar and Whitehead 1999) The only reported role of the C-terminal domain is its fac...

Ngày tải lên: 10/09/2015, 15:51

205 241 0
Báo cáo khoa học: The role of ADAM10 and ADAM17 in the ectodomain shedding of angiotensin converting enzyme and the amyloid precursor protein ppt

Báo cáo khoa học: The role of ADAM10 and ADAM17 in the ectodomain shedding of angiotensin converting enzyme and the amyloid precursor protein ppt

... that both ADAM10 and TACE are involved in the shedding of APP, neither ADAM is involved in the shedding of ACE Furthermore we show that APMA can distinguish between the shedding of ACE and APP ... would appear that ADAM10 and TACE are not critically involved in the shedding of ACE APMA has been reported to induce the shedding of a number of pro...

Ngày tải lên: 30/03/2014, 14:20

9 539 0
Investigation of the effects of serum amyloid a on human endothelial cells implications in atherosclerosis

Investigation of the effects of serum amyloid a on human endothelial cells implications in atherosclerosis

... not a major acute phase protein and has not been regarded as a biomarker of CAD 1.4 Endothelial proinflammation 1.4.1 Endothelial proinflammation in atherosclerosis Ross proposed in 1999 that atherosclerosis ... acute inflammation, its an-inflammatory function could be reduced 15 1.2.2 A biomarker of atherosclerosis The characterization of SAA as both an inflammato...

Ngày tải lên: 14/09/2015, 13:15

197 261 0
Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

Tài liệu The Role of Public Regional Universities in Community and Economic Development doc

... stable supply of knowledge and skills in high need areas Increase the size, diversity of skills and productivity of the labor force Dimensions of Social and Economic Value Regional public institutions ... business Best Practice Highlights Slippery Rock University Regional Learning Alliance – workforce development and training/collaborations with business and...

Ngày tải lên: 21/02/2014, 01:20

29 655 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

6 489 0
Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

Báo cáo khoa học: The role of interface framework residues in determining antibody VH ⁄ VL interaction strength and antigen-binding affinity pptx

... observed in weaker binders Evaluation of the VH ⁄ VL interaction strength To evaluate the VH ⁄ VL interaction strength of these 36 clones, phages were used to infect a nonsuppressing strain, HB2151, ... strong VH ⁄ VL binder, to describe the relationship, and also to identify key residues in determining the interdomain interaction stren...

Ngày tải lên: 07/03/2014, 12:20

11 462 0
Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

Báo cáo khoa học: "The Role of Lexico-Semantic Feedback in Open-Domain Textual Question-Answering" ppt

... Claire Cardie, Vincent Ng, David Pierce, Chris Buckley Examining the role of statistical and linguistic knowledge sources in a general-knowledge que stion answering system In Proceedings of the 6th ... periments with Open-Domain Textual Question Answering In the Proceedings of the 18th International Conference on Computational Linguistics (COLING-2000), pages 292298, 2000 Fr...

Ngày tải lên: 08/03/2014, 05:20

8 508 0
Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

Báo cáo " THE ROLE OF GIFT RECIPIENT PERCEPTION IN CHANGING BRAND ATTITUDES AND GIVER - RECIPIENT RELATIONSHIP " potx

... 5.2.) Hypothesis 2: When the gift recipient s perception of prior attitude toward a brand is neutral and the giver -recipient relationship is strong, then the gift recipient s post -brand attitude ... level of recipient s perception of prior brand attitudes - Hypothesis 7a: The recipient s post brand attitude change is greater when receiving the...

Ngày tải lên: 14/03/2014, 14:20

10 482 0
The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College Attendance pdf

... Sherraden, and Julia Stevens for comments CENTER FOR SOCIAL DEVELOPMENT WASHINGTON UNIVERSITY IN ST LOUIS i REDUCING WILT The Role of Savings and Wealth in Reducing ―Wilt‖ between Expectations and College ... Destin, 2009) Charles, Roscigno, and Torres (2007) is the only study of the seven to examine the relationship between parent school savings...

Ngày tải lên: 15/03/2014, 10:20

22 515 0
Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

Báo cáo khoa học: The role of glucose 6-phosphate in mediating the effects of glucokinase overexpression on hepatic glucose metabolism pdf

... glucokinase and hexokinase I in distinct pools [3,24], or by the involvement of mechanisms, additional to Glc6P, in mediating the effects of glucokinase overexpression As glucokinase binds to a dual-specificity ... [5,7] Conditions that cause dissociation of glucokinase from GKRP are associated with a parallel increase in the cell content of Glc6P, confirming...

Ngày tải lên: 16/03/2014, 14:20

11 504 0
Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

Báo cáo khoa học: "Examining the Role of Linguistic Knowledge Sources in the Automatic Identification and Classification of Reviews" doc

... (particularly the short ones) have all zeroes in them In other words, none of the bigrams from the training set appears in these reviews This suggests that the main problem with the bigram model ... and E Hovy 2004 Determining the sentiment of opinions In Proc of COLING, pages 1367–1373 M Koppel and J Schler 2005 Using neutral examples for learning polarity In...

Ngày tải lên: 17/03/2014, 04:20

8 489 0
Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf

... clear upregulation of an alkane-inducible cytochrome P450 (AJ273607) The role of P450 in microbial fatty acid metabolism during the first hours of incubation [22] According to amino acid similarity, ... compounds is inherently coupled to fatty acid degradation because the conversion of alkanes to fatty acids is The role of P450 in microbial...

Ngày tải lên: 22/03/2014, 16:21

16 565 0
The Role of Interest Rate Swaps in Corporate Finance doc

The Role of Interest Rate Swaps in Corporate Finance doc

... explains the basic mechanics of interest rate swaps and examines these rationales in more detail FUNDAMENTALS OF INTEREST RATE SWAPS The most common type of interest rate swap is the fixed/floating ... Fixed/Floating Swap The quoted price of an interest rate swap consists of two different interest rates In the case of a fixed/floating swap, the qu...

Ngày tải lên: 22/03/2014, 17:20

20 387 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand...

Ngày tải lên: 22/03/2014, 18:20

12 554 0
w