Surface science studies of graphene film and nanoislands
Surface science studies of graphene film and nanoislands
... SURFACE SCIENCE STUDIES OF GRAPHENE FILM AND NANOISLANDS LU JIONG (B.Sc Fudan University) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHYLOSOPHY DEPARTMENT OF CHEMISTRY NATIONAL ... results on STM and HREELS studies of two dimensional graphene films and graphene nanoislands In Chapter and 4, we investigate the k-space dependent plasmons behaviors of epitaxial graphene with ... semimetallic graphene band structure Figure 1.4 Calculated E(k) of zigzag ribbons [N = (a), N = (b), and N = (c)], calculated band structure of a zigzag ribbon (d), and the projected band structure of...
- 188
- 260
- 0
Surface science studies of diamond and mos2 moge films
... SURFACE SCIENCE STUDIES OF DIAMOND AND MoS2/ MoGe FILMS OUYANG TI (B.Sc Peking University) A DISSERTATION SUBMITTED FOR THE DEGREE OF DOCTOR OF PHYLOSOPHY DEPARTMENT OF CHEMISTRY ... point for the study on diamond surface The surface structure and reactivity of (100) and (111) surfaces on silicon and diamond are not identical On one hand, the existence of empty nd orbitals ... diagram of diamond (100) surfaces (a): diamond (100)-1×1 dihydride surface; (b): diamond (100)-2×1 monohydride surface; (c): diamond (100)2×1 hydrogen free surface The bulk-terminated (100) surface...
- 179
- 196
- 0
Tài liệu Euphorion Being Studies of the Antique and the Mediaeval in the Renaissance - Vol. II pot
... imagine the old knight, only half aware of the sunshine of the evening, the noise of the streets, the looks of the crowd, the great minster rising half-finished in the midst of the town by the ... and daughters -in- law, forming a hierarchy attending to the business of factory or counting-house under the orders of the father of the family, and to the economy of the house-under the superintendence ... joyous orange against the greenness of the hill Such spots there are and many in the winter of the Middle Ages; though it is not in them, but where the rain beats, and the snow and the wind tugs, that...
- 71
- 630
- 0
Tài liệu Báo cáo khoa học: "Predicting the fluency of text with shallow structural features: case studies of machine translation and human-written text" doc
... understand which factors are predictive of good fluency The distribution of fluency scores in the dataset is rather skewed, with the majority of the sentences rated as being of average fluency as ... assess the content of the sentence compared to a human gold-standard Yet, the assessments of the two aspects were often the same—readability /fluency of the sentence is important for understanding the ... from machine translations • Distinguish human and machine translations • Distinguish fluent machine translations from poor machine translations • Distinguish the better (in terms of fluency) translation...
- 9
- 438
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...
- 9
- 422
- 0
Báo cáo khoa học: Structural studies of nucleoside analog and feedback inhibitor binding to Drosophila melanogaster multisubstrate deoxyribonucleoside kinase doc
... structure of dNK has previously been determined in complexes with substrates and a feedback inhibitor [12,13] It has a structure similar to that of the human dGK and dCK and belongs to a structural ... specificity of dNK Earlier crystallographic studies of substrates dT and dC and on the structure of the feedback inhibitor complex with dTTP, as well as mutation studies, have established some of the ... positioned to form specific interactions to the sugar and the base of the substrate The 3¢-oxygen of deoxyribose is hydrogen bonded to Tyr70 and Glu172, and the 5¢-oxygen is hydrogen bonded to Glu52 and...
- 10
- 308
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C¼O C1 C2 C3 C4 C5 10 2.83 71. 54 67. 51 109. 41 147. 01 – 10 2.97 55.02 78.24 79.04 77. 41 63. 91 25.27 17 7.79 65. 61 74.58 73.04 82.89 76 .11 10 4.25 72.60 ... oligosaccharides from the chondroitin sulfates 1H-NMR and 13 C-NMR studies of reduced disaccharides and tetrasaccharides Eur J Biochem 268, 11 81 11 89 Bayliss MT, Osborne D, Woodhouse S & Davidson C (19 99) Sulfation ... three species of molluscs J Biol Chem 259, 14 31 14 35 12 Oliveira FW, Chavante SF, Santos EA, Dietrich CP & Nader HB (19 94) Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase,...
- 11
- 481
- 0
Báo cáo khoa học: Antimicrobial and conformational studies of the active and inactive analogues of the protegrin-1 peptide docx
... activity of the peptides A better understanding of the mode of action of these peptides is crucial for the development of a new generation of antibiotics It is known that, in the absence of both ... at the two spatial tips of the molecule, at the N-terminus with Arg1 and in the turn in the presence of Arg7 and Arg9 (see Figs and 4) The shorter analogue, BM-2, was the most flexible of all the ... mechanistic step in the killing of bacteria [16,20] The conformations of the structural features determining the antimicrobial activity of protegrins Conformational studies of protegrin-1 analogues were...
- 13
- 427
- 0
Model choice in time series studies of air pollution and mortality pdf
... for quantifying and characterizing model uncertainty in multicity time series studies of air pollution and mortality The complexity of the time series data requires the application of sophisticated ... comprehensive characterization of model choice and model uncertainty in time series studies of air pollution and mortality, focusing on confounding adjustment for seasonal and long-term trends We first identify ... of Time- series Studies of Air Pollution and Health, pp 9–24 Cambridge: Health Effects Institute Dominici, F., McDermott, A and Hastie, T (2004) Improved semiparametric time series models of air...
- 25
- 489
- 0
báo cáo hóa học: " Structural and thermal studies of silver nanoparticles and electrical transport study of their thin films" pdf
... al.: Structural and thermal studies of silver nanoparticles and electrical transport study of their thin films Nanoscale Research Letters 2011 6:434 Submit your manuscript to a journal and benefit ... http://www.nanoscalereslett.com/content/6/1/434 Page of A B Figure FETEM and HRTEM images of silver nanoparticles (a) FETEM image of silver nanoparticles (b) High-resolution image of a single silver nanoparticle and inset shows ... method for the preparation of silver nanoparticles and their thin films is simple, convenient, and viable which allows nanocrystalline silver particles of spherical shape and almost narrow size distribution...
- 8
- 384
- 0
Báo cáo y học: " Kinetic studies of HIV-1 and HIV-2 envelope glycoprotein-mediated fusion" potx
... this analysis by comparing only one HIV-1 and two HIV-2 strains we believe that the methodology developed here can be expanded to include comparisons between various strains of HIV-1 and HIV-2 Future ... virus type and type glycoproteins FEBS Lett 2000, 474:246-251 Puri A, Hug P, Munoz-Barroso I, Blumenthal R: Human erythrocyte glycolipids promote HIV-1 envelope glycoprotein-mediated fusion of CD4+ ... protein Virology 1993, 196:89-100 Kliger Y, Shai Y: A leucine zipper-like sequence from the cytoplasmic tail of the HIV-1 envelope glycoprotein binds and perturbs lipid bilayers Biochemistry 1997, 36:5157-5169...
- 8
- 221
- 0
Dynamic studies of type i and type II cadherins EC domains
... clustering mechanism of Type II cadherins is still unsolved, it probably is different from that of Type I cadherins This is because Type II cadherins lack the pseudo-β helix region which is indispensable ... I and Type II cadherins result in their distinct behaviour in vivo Type I cadherins, including E-cadherin, N-cadherin and C-cadherin etc., show stronger and more rapid adhesion than Type II cadherins ... Type I and Type II cadherins are critical for their physiology functions (2, 3) 1.2 Cadherin molecular structure and homophilic interaction between EC domains 1.2.1 Type I and Type II cadherins...
- 128
- 290
- 0
Synthetic studies of azido inositols and inositol based glycans 1
... 13 1. 6 Design and Hypothesis of Inositol Analogues for Metabolic Engineering 14 1. 7 General Synthetic Outline 18 iii Synthetic Studies of Azido- Inositols and Inositol- based Glycans ... Studies of Azido- Inositols and Inositol- based Glycans 2 012 Figure 3 .12 Incorporation of 5 -azido- inositol 1- 7b into phosphoinositides 82 Figure 3 .13 Incorporation of 3 -azido- inositol 1- 6b into ... resolution of (± )1- 45 25 Scheme 1. 9 Synthesis of chiral azido conduritol (+ )1- 49 and (- )1- 49 26 Scheme 1. 10 Synthesis of azido- inositols from azido conduritol (+ )1- 49 27 Scheme 1. 11 Synthesis...
- 291
- 232
- 0
Synthetic studies of azido inositols and inositol based glycans 2
... Spectra of the Selected Compounds in Chapter 20 12 20 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 21 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 22 Appendix ... Spectra of the Selected Compounds in Chapter 20 12 23 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 24 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 25 Appendix ... Spectra of the Selected Compounds in Chapter 20 12 26 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 27 Appendix 1: NMR Spectra of the Selected Compounds in Chapter 20 12 28 Appendix...
- 44
- 168
- 0
Từ khóa: evasion tax misery and ethics comparative studies of korea japan and chinafast diffusion of graphene flake and commensurate incommensurate phase transitionx ray diffraction studies of chitin chitosan and their derivativesex vivo multinuclear nmr spectroscopy of perfused respiring rat brain slices model studies of hypoxia ischemia and excitotoxicity quotslow surface negative potentials of the cortex and cortical inhibitionsarnat s growth studies of the orbit and upper facemethods available for studies of cftr folding and correctionstudies of drug resistance and the dynamic behavior of hiv 1 protease through molecular dynamics simulationsstudies of transgenic mice and of human genetic matrix diseasesin vitro toxicological studies of their biotransformation and potential negative effects3 human studies of maternal nutrition and induced epigenetic changestudies of the dispersed and continuous phasein vitro studies of cell proliferation and cell deathcooperating in preparing analyses and follow up studies of chemical accidents and proposing improvementsb— human studies of gallbladder dysmotility and gallstone pathogenesisNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ