Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation

Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation

Theoretical and experimental studies on nonlinear lumped element transmission lines for RF generation

... studied: a) nonlinear capacitive line (NLCL) where only the capacitive component is nonlinear; b) nonlinear inductive line (NLIL) where only the inductive component is nonlinear; and c) nonlinear ... rise time of the output pulse and only a handful reported having done simulations for RF generation These simulations for RF generation not include resistive losses and...

Ngày tải lên: 10/09/2015, 09:26

174 394 0
Theoretical and experimental studies on the promoting effect of boron on cobalt catalyst used for fischer tropsch synthesis

Theoretical and experimental studies on the promoting effect of boron on cobalt catalyst used for fischer tropsch synthesis

... THEORETICAL AND EXPERIMENTAL STUDIES ON THE PROMOTING EFFECT OF BORON ON COBALT CATALYST USED FOR FISCHER- TROPSCH SYNTHESIS (FTS) TAN KONG FEI (B Eng & M Phil., University of Malaya, ... Armando Borgna, Mark Saeys, Effect of Boron Promotion on the Stability of Cobalt Fischer- Tropsch catalyst , Journal of Catalysis, 280 (2011), 50 XX CH...

Ngày tải lên: 10/09/2015, 15:51

183 450 0
Theoretical and experimental investigation on nanostructures

Theoretical and experimental investigation on nanostructures

... will focus on the theoretical and experimental study of one-dimension nanostructures to control their physical properties and investigate their possible applications One-dimensional nanostructures, ... Electron densities of (a) the top valence band and (b) the bottom conduction band of ZZ-1 (6, 0); (c) the top valence band and (d) the bottom conduction band of ZZ-1 (9, 0); (e...

Ngày tải lên: 15/09/2015, 17:09

219 186 0
Experimental and numerical studies on the viscoelastic behavior of living cells

Experimental and numerical studies on the viscoelastic behavior of living cells

... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR...

Ngày tải lên: 12/09/2015, 11:01

191 275 0
Some experimental studies on vortex ring formation and interaction

Some experimental studies on vortex ring formation and interaction

... a Vortex Ring 3.5.4 Circulation of a Vortex Ring 63 65 65 67 67 3.6 Experimental Conditions 69 Chapter Results & Discussion 4.1 Circular Vortex Rings 4.1.1 Formation of the a Circular Vortex Ring ... interesting and complicated dynamics The third section reviews some past studies on the interaction of a vortex ring with a circular cylinder, and discussion on...

Ngày tải lên: 16/10/2015, 15:36

209 528 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purificat...

Ngày tải lên: 18/02/2014, 16:20

13 514 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

7 478 0
Báo cáo hóa học: " Research Article Audio Key Finding: Considerations in System Design and Case Studies on Chopin’s 24 Preludes" pdf

Báo cáo hóa học: " Research Article Audio Key Finding: Considerations in System Design and Case Studies on Chopin’s 24 Preludes" pdf

... national and international conferences such as the International Conference on Music Information Retrieval (ISMIR), International Conference on Multimedia and Expo (ICME), and the INFORMS Computing Society’s ... [3] C.-H Chuan and E Chew, “Fuzzy analysis in pitch-class determination for polyphonic audio key finding,” in Proceedings of the 6th International Conference on M...

Ngày tải lên: 22/06/2014, 23:20

15 426 0
Báo cáo y học: "Figuring out what works: a need for more and better studies on the relationship between ICU organization and outcomes" potx

Báo cáo y học: "Figuring out what works: a need for more and better studies on the relationship between ICU organization and outcomes" potx

... includes the training and organization of intensivists With a virtual absence of information relating ICU training with ICU outcomes, many questions remain unanswered Is there an optimal duration of ... Keller A, Tarlov AR, Ware JE: Variations in resource utilization among medical specialties and systems of care: results from the Medical Outcomes Study JAMA 1992, 267:1624-163...

Ngày tải lên: 13/08/2014, 20:21

2 271 0
Theoretical and simulation study on ogston sieving of biomolecules using continuum transport theory

Theoretical and simulation study on ogston sieving of biomolecules using continuum transport theory

... describe sieving, diffusion and convection of a band of biomolecules passing through a repeated array of nanofilters 14 Chapter Introduction 1.4 Organization of the thesis This thesis is composed of ... approaches 2.1 Free-solution diffusion coefficient of rod-like DNA Diffusion of particles in a solution from a region of high concentration to regions of low concentrati...

Ngày tải lên: 11/09/2015, 09:03

125 319 0
w