Expression and editing of MicroRNA 376 cluster in human glioblastomas role in tumor growth and invasion

... EXPRESSION AND EDITING OF MICRORNA- 376 CLUSTER IN HUMAN GLIOBLASTOMAS: ROLE IN TUMOR GROWTH AND INVASION YUKTI CHOUDHURY (B.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... Analysis of Adenosine-to-Inosine editing of miR376 cluster in gliomas 63 Introduction and aims 63 3.2 Editing analysis of primary miRNAs in glioma...

Ngày tải lên: 10/09/2015, 08:28

... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...

Ngày tải lên: 09/09/2015, 10:17

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

... considering the unfinished character of the Physcomitrella genome sequence In regards to the maturation pathways of miRNAs, the prediction of genomic precursors revealed some interesting aspects of the ... Gregor Gierga for introducing us to the small RNA gel blots, Stefan Rensing and Sandra Richardt for help in performing the bioinformatic analyses This work was...

Ngày tải lên: 12/08/2014, 05:20

... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjec...

Ngày tải lên: 02/10/2015, 17:14

... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjec...

Ngày tải lên: 04/10/2015, 16:03

... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjec...

Ngày tải lên: 04/10/2015, 16:12

... present in normal cells as well as in tumor cells However, in tumor cells the importance of the objectives and thus their relative share in total glucose utilization varies during different stages of ... [115] reported the finding of two potential binding sites for HIF-1 in the first intron of the PK-M gene On the other hand, Yamada and Noguchi [116] re...

Ngày tải lên: 14/03/2014, 23:20

... finding for the GWBI) This is in line with results of a study in which GH was discontinued in young adults with GHD [45] where a significant increase in psychological complaints (on the Hopkins ... effects of withdrawal of growth hormone therapy from adults with growth hormone deficiency Clinical Endocrinology 2003, 59(4):467-475 McMillan CV: A psychometric evaluatio...

Ngày tải lên: 20/06/2014, 15:20

... human OvCa cells and tissues in comparison to non-cancerous samples Additionally, we show that CCL25 modulates MMP expression and enhances the migration and invasive potential of OvCa cells These ... http://www.wjso.com/content/8/1/62 Page of 10 Figure CCR9 mRNA and cell surface protein expressed by ovarian cancer cells Total RNA was isolated from OVCAR-3 and CAOV-3 cell l...

Ngày tải lên: 09/08/2014, 03:21

... homogenized in a solution containing mM EDTA, 0.5 mM aminoethylbenezenesulfonyl fluoride (AEBSF), μg/ml Leupeptin, μg/ml Aprotinin, 10 μg/ml Trypsin-Chymotrypsin inhibitor, μg/ml Pepstatin A (all ... postulated that PlGF may be involved in the inflammatory process related to emphysema This study aimed to test this hypothesis by determining whether emphysema could be prevented in mic...

Ngày tải lên: 12/08/2014, 14:20

... to TAMs in other parts of the tumor [8,30] In summary, inflammation and the immune system play critical roles in both tumor suppression and tumor progression Understanding the complex interactions ... unique Therefore, the study of the cross-talk between cancer cells and the immune system must be analyzed in the context of the organ in which th...

Ngày tải lên: 10/09/2015, 15:50

... is the number of melanoma cells at the end of the experiment, N is the number of melanoma cells at the onset of the experiment, k is the fraction of proliferating cells, t is the duration of the ... is the fraction of proliferating cells in the tumor of control mice and k d is the fraction of proliferating cells in the tumor of PMN-MDSC-de...

Ngày tải lên: 10/09/2015, 15:50

... [41] Interestingly, eIF6 expression was unaltered in EC cells This indicates the complexity of miRNA biosynthesis regulatory mechanisms in EC stem cells and tumours This mechanism is clearly linked ... state In NTera2 cells, differentiation status is confirmed by decreases in expression of Oct4 and Nanog and increases in expression of Afp, Ncam1 and...

Ngày tải lên: 20/06/2014, 07:20

... Purification and refolding of N-terminal His-tagged gAd-GLP-1-A fusion protein The fusion protein was purified by High-Affinity Ni-IDA Resin After filtering, the fusion protein was bound in the column ... by improving both insulin resistance and insulin secretion deficiency However, we only observed the glucose-lowering effect of the whole fusion protein in thi...

Ngày tải lên: 25/10/2012, 11:10