Expression and editing of MicroRNA 376 cluster in human glioblastomas role in tumor growth and invasion
Expression and editing of MicroRNA 376 cluster in human glioblastomas role in tumor growth and invasion
... EXPRESSION AND EDITING OF MICRORNA- 376 CLUSTER IN HUMAN GLIOBLASTOMAS: ROLE IN TUMOR GROWTH AND INVASION YUKTI CHOUDHURY (B.Sc., NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... Analysis of Adenosine-to-Inosine editing of miR376 cluster in gliomas 63 Introduction and aims 63 3.2 Editing analysis of primary miRNAs in gliomas 3.3 Editing analysis of primary miRNAs in glioma ... site-specific editing Similarity of structures and location of editing sites in coding sequences of Gabra-3 and GluR-B, and non-coding sequences of pri-miR-376c and pri-miR-376a2 Adapted from (Wahlstedt and...
- 200
- 392
- 0
Biochemical identification and functional characterization of microrna target interactions in growth control and cancer transformation
... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and a bipartite C- 28 terminal silencing ... As shown in Fig 1.2, Ago are large proteins about 100kDa comprising a single variable N-terminal domain and three conserved C-terminal domains, including the PAZ, MID and PIWI domains (Vaucheret,...
- 141
- 474
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
- 6
- 488
- 0
báo cáo khoa học: " Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" docx
... considering the unfinished character of the Physcomitrella genome sequence In regards to the maturation pathways of miRNAs, the prediction of genomic precursors revealed some interesting aspects of the ... Gregor Gierga for introducing us to the small RNA gel blots, Stefan Rensing and Sandra Richardt for help in performing the bioinformatic analyses This work was supported by the Landesstiftung ... [23,24] In plants, homologs of Drosha or its cofactors could not be identified Furthermore, in Arabidopsis the Dicer-like protein is a nuclear protein suggesting that maturation of miRNAs in plants...
- 19
- 329
- 0
DISTINCTIVE CHARACTERISTICS OF INSULIN GLUCOSE METABOLISM IN INTRAUTERINE GROWTH RESTRICTED AND IMPAIRED GLUCOSE TOLERANCE NONHUMAN PRIMATES
... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjects were accelerated at the beginning and thus ... protein serine/threonine kinase protein serine/threonine kinase transmembrane receptor protein tyrosine kinase adaptor 3-phosphoinositidedependent protein serine/threonine kinase phosphorylation and...
- 94
- 299
- 0
DISTINCTIVE CHARACTERISTICS OF INSULIN GLUCOSE METABOLISM IN INTRAUTERINE GROWTH RESTRICTED AND IMPAIRED GLUCOSE TOLERANCE NONHUMAN PRIMATES
... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjects were accelerated at the beginning and thus ... protein serine/threonine kinase protein serine/threonine kinase transmembrane receptor protein tyrosine kinase adaptor 3-phosphoinositidedependent protein serine/threonine kinase phosphorylation and...
- 94
- 342
- 0
DISTINCTIVE CHARACTERISTICS OF INSULIN GLUCOSE METABOLISM IN INTRAUTERINE GROWTH RESTRICTED AND IMPAIRED GLUCOSE TOLERANCE NONHUMAN PRIMATES
... Fasting hyperglycemia and glucose (30% ) intolerance observed in IUGR Table 1: Summary of studies using IUGR rodent model and exhibit changes in organs and gene involving in insulin- glucose metabolism ... SLC2A4RG, and fold decrease in MSTN, indicating elevated insulin- glucose signaling All these conclude that the insulin glucose metabolism in IUGR subjects were accelerated at the beginning and thus ... protein serine/threonine kinase protein serine/threonine kinase transmembrane receptor protein tyrosine kinase adaptor 3-phosphoinositidedependent protein serine/threonine kinase phosphorylation and...
- 94
- 362
- 0
Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt
... present in normal cells as well as in tumor cells However, in tumor cells the importance of the objectives and thus their relative share in total glucose utilization varies during different stages of ... [115] reported the finding of two potential binding sites for HIF-1 in the first intron of the PK-M gene On the other hand, Yamada and Noguchi [116] reported that there is no HIF-1 binding sequence ... melanoma cells, elevation of the cellular Ca2+ concentration leads to detachment of PFK from the cytoskeleton and thus diminishes the provision of local ATP in the vicinity of the cytoskeleton [71] The...
- 24
- 454
- 0
báo cáo hóa học:" Psychometric properties of two measures of psychological well-being in adult growth hormone deficiency" pot
... finding for the GWBI) This is in line with results of a study in which GH was discontinued in young adults with GHD [45] where a significant increase in psychological complaints (on the Hopkins ... effects of withdrawal of growth hormone therapy from adults with growth hormone deficiency Clinical Endocrinology 2003, 59(4):467-475 McMillan CV: A psychometric evaluation of measures of quality of ... Measuring psychological well-being The adapted general well- being index in a primary care setting: A test of validity Fam Pr 1995, 12(4):452-460 Gaston JE, Vogl L: Psychometric properties of the...
- 10
- 613
- 0
Báo cáo khoa học: "CCL25-CCR9 interaction modulates ovarian cancer cell migration, metalloproteinase expression, and invasion" pot
... human OvCa cells and tissues in comparison to non-cancerous samples Additionally, we show that CCL25 modulates MMP expression and enhances the migration and invasive potential of OvCa cells These ... http://www.wjso.com/content/8/1/62 Page of 10 Figure CCR9 mRNA and cell surface protein expressed by ovarian cancer cells Total RNA was isolated from OVCAR-3 and CAOV-3 cell lines and normal primary ovary tissue Quantitative ... PE-positive cells are shown Asterisk(s) indicate statistical significance (p < 0.01) between normal tissue and OvCa cells Figure CCR9-mediated ovarian cancer cell migration and invasion (A) OVCAR-3 and...
- 10
- 232
- 0
Báo cáo y học: " Prevention of elastase-induced emphysema in placenta growth factor knock-out mice" doc
... homogenized in a solution containing mM EDTA, 0.5 mM aminoethylbenezenesulfonyl fluoride (AEBSF), μg/ml Leupeptin, μg/ml Aprotinin, 10 μg/ml Trypsin-Chymotrypsin inhibitor, μg/ml Pepstatin A (all ... postulated that PlGF may be involved in the inflammatory process related to emphysema This study aimed to test this hypothesis by determining whether emphysema could be prevented in mice whose PlGF ... considerably less in panel Bar severity (PlGF +/-, of The = 100 μm) emphysema is (original magnification × 40; The severity of emphysema is considerably less in panel (PlGF +/-, heterozygous type)...
- 10
- 245
- 0
ROLE OF THE IMMUNE SYSTEM IN TUMOR PROGRESSION 1
... to TAMs in other parts of the tumor [8,30] In summary, inflammation and the immune system play critical roles in both tumor suppression and tumor progression Understanding the complex interactions ... unique Therefore, the study of the cross-talk between cancer cells and the immune system must be analyzed in the context of the organ in which the tumor exists and the type of cells that the tumor ... and/or (2) allow metastasis of tumor cells These functions vary depending on the type of tumor and the location of the TAMs in the tumor e.g TAMs in hypoxic areas of the tumor express more angiogenic...
- 173
- 528
- 0
ROLE OF THE IMMUNE SYSTEM IN TUMOR PROGRESSION 2
... is the number of melanoma cells at the end of the experiment, N is the number of melanoma cells at the onset of the experiment, k is the fraction of proliferating cells, t is the duration of the ... is the fraction of proliferating cells in the tumor of control mice and k d is the fraction of proliferating cells in the tumor of PMN-MDSC-depleted mice For tumors with ellipsoid shape, the ... is the number of melanoma cells at the end of the experiment, N is the number of melanoma cells at the onset of the experiment, k is the fraction of proliferating cells, t is the duration of the...
- 10
- 278
- 0
báo cáo hóa học:" Regulation of microRNA biosynthesis and expression in 2102Ep embryonal carcinoma stem cells is mirrored in ovarian serous adenocarcinoma patients" pdf
... [41] Interestingly, eIF6 expression was unaltered in EC cells This indicates the complexity of miRNA biosynthesis regulatory mechanisms in EC stem cells and tumours This mechanism is clearly linked ... state In NTera2 cells, differentiation status is confirmed by decreases in expression of Oct4 and Nanog and increases in expression of Afp, Ncam1 and Eno3 2102Ep cells alter expression of these ... Expression of miRNA biosynthesis genes andEC cells miRExpression of miRNA biosynthesis genes and mature miRNAs in undifferentiated NTera2 and 2102Ep EC cells The relative expression levels of miRNA biosynthesis...
- 16
- 291
- 0
Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"
... Purification and refolding of N-terminal His-tagged gAd-GLP-1-A fusion protein The fusion protein was purified by High-Affinity Ni-IDA Resin After filtering, the fusion protein was bound in the column ... by improving both insulin resistance and insulin secretion deficiency However, we only observed the glucose-lowering effect of the whole fusion protein in this study We could not determine which ... part of the fusion protein has this effect The effect might due to either one part of fusion protein or both of them In other words, we need to know whether each part of the fusion protein play glucose-lowering...
- 7
- 612
- 0
Từ khóa: deficiency in inducing green liver symptom and effect of dietary taurine supplementation in improving growth in juvenile red sea bream pagrus major fed non fishmeal diets based on soy protein concentratealternative econometric approaches for analyzing the role of the financial sector in economic growthrole of capital market authority in enhancing growth in the economythe role of mesenchymal stem cells in tumor microenvironmentexpression and function of stromal androgen receptor in prostate cancermethods for analyzing microrna expression and function during osteogenic differentiation of human adipose tissue dexpression and function of pluripotency genes in adult stem cellscloning expression and purification of monoclonal antibodies in scfv fc format1β gene expression and vasogenic edema development in a porcine model of intracerebral hemorrhage pdftypes differential expression and structural modification of cspgs in various cancer types1β expression and action in the absence of neuropathologycloning expression and purification of idps in pfs 2cloning expression and purification of idps in the pfs 2expression of reactive oxygen species in junctional and pocket epitheliumapplication of microrna in cardiac and skeletal muscle disease gene therapyBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ