Experimental determination of the nuclear magnetic octupole moment of 137ba

... present and compare the three values we obtained for the the nuclear magnetic octupole moment We also discuss how the value of the octupole moment compares with theory We then discuss future ... nuclear magnetic octupole moment Hence, the observation of the hyperfine (C) constant constitutes observation of the octupole moment The first experiment in...

Ngày tải lên: 09/09/2015, 11:20

... HIFU energy and pancreas histology, a preclinical in vivo study was conducted in swine demonstrating the feasibility and safety of HIFU for pancreas ablation [13] In the present study, we aimed to ... In the Group A, laparotomy was performed, and the pancreas was ablated directly through the surface of the pancreas with an HIFU transducer In the Grou...

Ngày tải lên: 25/10/2012, 11:18

... means of three replicates with standard error (SE) 989 Determination of the digestibility of some plant ingredients for grass carp (Ctenopharyngodon idella) Table The digestibility of protein of ... This digestibility value was high and 3.2 The digestibility of protein Table shows the digestibility of protein of three plant- ingredients...

Ngày tải lên: 28/08/2013, 09:14

... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature /solar radiation” for August from the present study and the published data [1] for June Figure 14 The time...

Ngày tải lên: 05/09/2013, 15:28

... expresses the effect of ambient gas composition and f describes the change of surface reactivity as a function of the fractional burn off: As the function g(Po2) represented the partial pressure of ... can be found in a previous study [11] Results and discussion 4.1 Characterization of the fuels A comparison of the proximate and ultimate analysis results, as...

Ngày tải lên: 05/09/2013, 15:28

... the technique of thermoluminecence dating [5,6] Fig the measurement of the gamma dose rate using the radiometer CΡΠ-68-01 This paper presents a new method to evaluate the annual beta dose (Dβ )by ... ages obtained are compared with the radiocarbon ones Preliminary results illustrate that the determination of the annual beta dose using the liquid...

Ngày tải lên: 13/02/2014, 04:20

... little study of the roots of trees is practicable, some knowledge of their forms, varieties, and parts is important The great office of the roots of all plants is the taking in of food from the soil ... chance for the constant growth of the trunk The different kinds of trees are readily known by the appearance of the bark of the trunk, due t...

Ngày tải lên: 13/02/2014, 12:20

... A2 for main-chain atoms, 35.7 A2 for side-chain ˚ overall (3 244 atoms) For the pepatoms and 33.8 A tide, B factors are slightly higher than those for ˚ ˚ importin -a: 36.9 A2 for main-chain atoms, ... atoms, 40 .2 A2 for ˚ overall (62 total atoms) side-chain atoms and 38.7 A Electron density analysis Both the main-chain and side-chain atoms of the modelled CLIC4 peptide...

Ngày tải lên: 14/02/2014, 19:20

... Identification of eEF1A as a nuclear protein specifically related to the cytotoxicity of GT oligomer in cancer cells In order to identify the nuclear proteins that specifically recognize cytotoxic GT oligomers, ... by cytotoxic GT oligomers and their selective binding to nuclear eEF1A In fact, in normal human lymphocytes no appreciable bi...

Ngày tải lên: 21/02/2014, 00:20

... attached to Thr3 enhances binding affinity of glycopeptides to the antibody [18] Conventional pepscan analysis however, does not allow easy analysis of the contribution of the carbohydrate portion To ... TSAPDTRPAPGST and the antibody SM3 was determined by Dokurno et al [19] They report a significant contribution of Arg4 to binding by analyzing the su...

Ngày tải lên: 21/02/2014, 15:20

... means of three replicates with standard error (SE) 989 Determination of the digestibility of some plant ingredients for grass carp (Ctenopharyngodon idella) Table The digestibility of protein of ... This digestibility value was high and 3.2 The digestibility of protein Table shows the digestibility of protein of three plant- ingredients...

Ngày tải lên: 25/02/2014, 10:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindII...

Ngày tải lên: 06/03/2014, 01:20

... of glutathione and glutathione disulde in human plasma and tobacco leaves by capillary electrophoresis with laser-induced uorescence detection Talanta 65, 986990 Svardal AM, Mansoor MA & Ueland ... curve and the regression equation The average recovery test was made using the standard addition method, and the RSD was generally good when obtained from a series of six plasma s...

Ngày tải lên: 07/03/2014, 05:20

... for emerin Emerin is the product of a gene linked to EDMD [19,21] An integral membrane protein specifically located at the inner nuclear membrane, emerin, like other INM proteins, binds to lamins ... mislocalization of emerin that is caused by the loss of emerin binding to lamin A (X- linked form) or by the loss of lamin A (autosomal dominant form) [22,23] Several...

Ngày tải lên: 07/03/2014, 12:20

... nuclear localization for the mSMOl isoform (Fig 4) Taken together, these results consistently substantiate the hypothesis that these two structural regions are mandatory for the nuclear localization ... v) paraformaldehyde in NaCl ⁄ Pi (15 at °C) to evaluate the subcellular localization of the various isoforms Determination of the subcellular localization...

Ngày tải lên: 07/03/2014, 17:20